LIVIVO - Search results -

Search results

Result 1 - 10 of total 18

Search options

Article ; Online: Human iPSC-derived brain organoids: A 3D mini-brain model for studying HIV infection.

Wei, Zhengyu / Bodnar, Brittany / Zhao, Ruo-Tong / Xiao, Qianhao / Saribas, Sami / Wang, Xu / Ho, Wen-Zhe / Hu, Wenhui

2023 Volume 364, Page(s) 114386

Abstract: The brain is one of the important reservoir sites for HIV persistent/latent infection that often leads to HIV-associated neurocognitive disorders (HAND). However, HIV dynamics in the brain is an understudied area and little is known about mechanisms ... ...

Abstract	The brain is one of the important reservoir sites for HIV persistent/latent infection that often leads to HIV-associated neurocognitive disorders (HAND). However, HIV dynamics in the brain is an understudied area and little is known about mechanisms underlying the development and progression of HAND. This issue is mainly due to the lack of suitable in vitro models that can recapitulate the cellular and molecular complexity of the human brain. Hence, there is an urgent need for such models to study HIV neuropathogenesis and to develop therapeutics for HAND. The emergence of three-dimensional (3D) brain organoids generated from induced pluripotent stem cells (iPSCs) has now provided a clinically relevant in vitro model to study HIV brain infection and neuropathogenesis. Recently, there have been a noticeable number of publications that demonstrate the feasibility and advantages of this model for studies of neurobiology and brain disorders as well as HIV infection. Here, we describe the development of iPSC-derived human microglia-containing brain organoids, including advantages/challenges, and focus on their applicability for modeling HIV brain infection.
MeSH term(s)	Humans ; Induced Pluripotent Stem Cells ; HIV Infections ; Brain/pathology ; Organoids
Language	English
Publishing date	2023-03-17
Publishing country	United States
Document type	Journal Article ; Research Support, N.I.H., Extramural
ZDB-ID	207148-4
ISSN	1090-2430 ; 0014-4886
ISSN (online)	1090-2430
ISSN	0014-4886
DOI	10.1016/j.expneurol.2023.114386
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 184: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (1.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Certified Registered Nurse Anesthetists' Adherence to an Intraoperative Lung Protective Ventilation Protocol.

Trethewey, Brittany N / Bukowy, Brooks M / Bodnar, Stephan J / Migliarese, Jaclyn E / Falyar, Christian R / Harris, Erica M / Simmons, Virginia C / Silva, Susan G

AANA journal

2021 Volume 89, Issue 5, Page(s) 419–427

Abstract: The clinical application of intraoperative mechanical ventilation is highly variable and often determined by providers' attitudes and preferences, rather than evidence. Ventilation strategies using high tidal volumes ( ... ...

Abstract	The clinical application of intraoperative mechanical ventilation is highly variable and often determined by providers' attitudes and preferences, rather than evidence. Ventilation strategies using high tidal volumes (V
MeSH term(s)	Adult ; Humans ; Lung ; Nurse Anesthetists ; Positive-Pressure Respiration ; Postoperative Complications ; Respiration, Artificial ; Tidal Volume
Language	English
Publishing date	2021-09-29
Publishing country	United States
Document type	Journal Article ; Multicenter Study
ZDB-ID	603605-3
ISSN	2162-5239 ; 0094-6354
ISSN (online)	2162-5239
ISSN	0094-6354
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 1286: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (1.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Cellular mechanisms underlying neurological/neuropsychiatric manifestations of COVID-19.

Bodnar, Brittany / Patel, Kena / Ho, Wenzhe / Luo, Jin Jun / Hu, Wenhui

Journal of medical virology

2020 Volume 93, Issue 4, Page(s) 1983–1998

Abstract: Patients with severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) infection manifest mainly respiratory symptoms. However, clinical observations frequently identified neurological symptoms and neuropsychiatric disorders related to COVID-19 ( ... ...

Abstract	Patients with severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) infection manifest mainly respiratory symptoms. However, clinical observations frequently identified neurological symptoms and neuropsychiatric disorders related to COVID-19 (Neuro-SARS2). Accumulated robust evidence indicates that Neuro-SARS2 may play an important role in aggravating the disease severity and mortality. Understanding the neuropathogenesis and cellular mechanisms underlying Neuro-SARS2 is crucial for both basic research and clinical practice to establish effective strategies for early detection/diagnosis, prevention, and treatment. In this review, we comprehensively examine current evidence of SARS-CoV-2 infection in various neural cells including neurons, microglia/macrophages, astrocytes, pericytes/endothelial cells, ependymocytes/choroid epithelial cells, and neural stem/progenitor cells. Although significant progress has been made in studying Neuro-SARS2, much remains to be learned about the neuroinvasive routes (transneuronal and hematogenous) of the virus and the cellular/molecular mechanisms underlying the development/progression of this disease. Future and ongoing studies require the establishment of more clinically relevant and suitable neural cell models using human induced pluripotent stem cells, brain organoids, and postmortem specimens.
MeSH term(s)	Animals ; Brain/pathology ; Brain/virology ; COVID-19/pathology ; Cell Line ; Humans ; Nervous System Diseases/pathology ; Nervous System Diseases/virology ; Neural Stem Cells ; Neuroglia/pathology ; Neuroglia/virology ; Neurons/pathology ; Neurons/virology
Language	English
Publishing date	2020-12-23
Publishing country	United States
Document type	Journal Article ; Research Support, N.I.H., Extramural ; Review
ZDB-ID	752392-0
ISSN	1096-9071 ; 0146-6615
ISSN (online)	1096-9071
ISSN	0146-6615
DOI	10.1002/jmv.26720
Database	MEDical Literature Analysis and Retrieval System OnLINE

Full text online

Accessible to users with ZB MED library card

In stock of ZB MED Cologne/Königswinter

Zs.A 1320: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (1.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾

Article: Microglia-Specific Promoter Activities of

Shah, Sahil / Wong, Lilly M / Ellis, Kendra / Bodnar, Brittany / Saribas, Sami / Ting, Julia / Wei, Zhengyu / Tang, Yuyang / Wang, Xianwei / Wang, Hong / Ling, Binhua / Margolis, David M / Garcia, J Victor / Hu, Wenhui / Jiang, Guochun

Frontiers in cellular neuroscience

2022 Volume 16, Page(s) 808598

Abstract: Adeno-associated virus (AAV)-mediated genetic targeting of microglia remains a challenge. Overcoming this hurdle is essential for gene editing in the central nervous system (CNS). Here, we characterized the minimal/native promoter of ... ...

Abstract	Adeno-associated virus (AAV)-mediated genetic targeting of microglia remains a challenge. Overcoming this hurdle is essential for gene editing in the central nervous system (CNS). Here, we characterized the minimal/native promoter of the
Language	English
Publishing date	2022-03-10
Publishing country	Switzerland
Document type	Journal Article
ZDB-ID	2452963-1
ISSN	1662-5102
ISSN	1662-5102
DOI	10.3389/fncel.2022.808598
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Article ; Online: Neuronal AR Regulates Glucose Homeostasis and Energy Expenditure in Lean Female Mice With Androgen Excess.

Ubba, Vaibhave / Joseph, Serene / Awe, Olubusayo / Jones, Dustin / Dsilva, Milan K / Feng, Mingxiao / Wang, Junjiang / Fu, Xiaomin / Akbar, Razeen J / Bodnar, Brittany H / Hu, Wenhui / Wang, Hong / Yang, Xiaofeng / Yang, Ling / Yang, Peixin / Ahima, Rexford / Divall, Sara / Wu, Sheng

Endocrinology

2023 Volume 164, Issue 11

Abstract: Hyperandrogenemia and polycystic ovary syndrome are a result of the imbalance of androgen levels in females. Androgen receptor (Ar) mediates the effect of androgen, and this study examines how neuronal Ar in the central nervous system mediates metabolism ...

Abstract	Hyperandrogenemia and polycystic ovary syndrome are a result of the imbalance of androgen levels in females. Androgen receptor (Ar) mediates the effect of androgen, and this study examines how neuronal Ar in the central nervous system mediates metabolism under normal and increased androgen conditions in female mice. The neuron-specific ARKO mouse (SynARKO) was created from female (Ar fl/wt; synapsin promoter driven Cre) and male (Ar fl/y) mice. A glucose tolerance test revealed impaired glucose tolerance that was partially alleviated in the SynARKO-dihydrotestosterone (DHT) mice compared with Con-DHT mice after 4 months of DHT treatment. Heat production and food intake was higher in Con-DHT mice than in Con-veh mice; these effects were not altered between SynARKO-veh and SynARKO-DHT mice, indicating that excess androgens may partially alter calorie intake and energy expenditure in females via the neuronal Ar. The pAkt/Akt activity was higher in the hypothalamus in Con-DHT mice than in Con-veh mice, and this effect was attenuated in SynARKO-DHT mice. Western blot studies show that markers of inflammation and microglia activation, such as NF-kB p-65 and IBA1, increased in the hypothalamus of Con-DHT mice compared with Con-veh. These studies suggest that neuronal Ar mediates the metabolic impacts of androgen excess in females.
Language	English
Publishing date	2023-09-20
Publishing country	United States
Document type	Journal Article
ZDB-ID	427856-2
ISSN	1945-7170 ; 0013-7227
ISSN (online)	1945-7170
ISSN	0013-7227
DOI	10.1210/endocr/bqad141
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Uh III Zs.72: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Reproductive Profile of Neuronal Androgen Receptor Knockout Female Mice With a Low Dose of DHT.

Endocrinology

2023 Volume 165, Issue 3

Abstract: Hyperandrogenism and polycystic ovarian syndrome result from the imbalance or increase of androgen levels in females. Androgen receptor (AR) mediates the effects of androgens, and this study examines whether neuronal AR plays a role in reproduction under ...

Abstract	Hyperandrogenism and polycystic ovarian syndrome result from the imbalance or increase of androgen levels in females. Androgen receptor (AR) mediates the effects of androgens, and this study examines whether neuronal AR plays a role in reproduction under normal and increased androgen conditions in female mice. The neuron-specific AR knockout (KO) mouse (SynARKO) was generated from a female mouse (synapsin promoter driven Cre) and a male mouse (Ar fl/y). Puberty onset and the levels of reproductive hormones such as LH, FSH, testosterone, and estradiol were comparable between the control and the SynARKO mice. There were no differences in cyclicity and fertility between the control and SynARKO mice, with similar impairment in both groups on DHT treatment. Neuronal AR KO, as in this SynARKO mouse model, did not alleviate the infertility associated with DHT treatment. These studies suggest that neuronal AR KO neither altered reproductive function under physiological androgen levels, nor restored fertility under hyperandrogenic conditions.
MeSH term(s)	Humans ; Female ; Male ; Mice ; Animals ; Androgens/pharmacology ; Receptors, Androgen/genetics ; Mice, Knockout ; Sexual Maturation ; Polycystic Ovary Syndrome ; Reproduction/genetics ; Neurons
Chemical Substances	Androgens ; Receptors, Androgen
Language	English
Publishing date	2023-12-28
Publishing country	United States
Document type	Journal Article
ZDB-ID	427856-2
ISSN	1945-7170 ; 0013-7227
ISSN (online)	1945-7170
ISSN	0013-7227
DOI	10.1210/endocr/bqad199
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Uh III Zs.72: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Zhu, Yuanjun / Saribas, A Sami / Liu, Jinbiao / Lin, Yuan / Bodnar, Brittany / Zhao, Ruotong / Guo, Qian / Ting, Julia / Wei, Zhengyu / Ellis, Aidan / Li, Fang / Wang, Xu / Yang, Xiaofeng / Wang, Hong / Ho, Wen-Zhe / Yang, Ling / Hu, Wenhui

Molecular therapy : the journal of the American Society of Gene Therapy

2023 Volume 31, Issue 4, Page(s) 1136–1158

Abstract: Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase ...

Abstract	Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.
MeSH term(s)	Humans ; COVID-19 ; SARS-CoV-2/genetics ; Signal Transduction ; Viral Vaccines ; RNA, Messenger/genetics
Chemical Substances	Viral Vaccines ; RNA, Messenger
Language	English
Publishing date	2023-02-14
Publishing country	United States
Document type	Journal Article ; Research Support, Non-U.S. Gov't ; Research Support, N.I.H., Extramural
ZDB-ID	2010592-7
ISSN	1525-0024 ; 1525-0016
ISSN (online)	1525-0024
ISSN	1525-0016
DOI	10.1016/j.ymthe.2023.02.012
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 5640: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (2.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article: Comparison of BNT162b2-, mRNA-1273- and Ad26.COV2.S-Elicited IgG and Neutralizing Titers against SARS-CoV-2 and Its Variants.

Padhiar, Nigam H / Liu, Jin-Biao / Wang, Xu / Wang, Xiao-Long / Bodnar, Brittany H / Khan, Shazheb / Wang, Peng / Khan, Adil I / Luo, Jin-Jun / Hu, Wen-Hui / Ho, Wen-Zhe

Vaccines

2022 Volume 10, Issue 6

Abstract: Because the vaccine-elicited antibody and neutralizing activity against spike protein of SARS-CoV-2 are associated with protection from COVID-19, it is important to determine the levels of specific IgG and neutralization titers against SARS-CoV-2 ... ...

Abstract	Because the vaccine-elicited antibody and neutralizing activity against spike protein of SARS-CoV-2 are associated with protection from COVID-19, it is important to determine the levels of specific IgG and neutralization titers against SARS-CoV-2 elicited by the vaccines. While three widely used vaccine brands (Pfizer-BNT162b2, Moderna-mRNA-1273 and Johnson-Ad26.COV2.S) are effective in preventing SARS-CoV-2 infection and alleviating COVID-19 illness, they have different efficacy against COVID-19. It is unclear whether the differences are due to varying ability of the vaccines to elicit a specific IgG antibody response and neutralization activity against spike protein of the virus. In this study, we compared the plasma IgG and neutralization titers against spike proteins of wild-type SARS-CoV-2 and eight variants in healthy subjects who received the mRNA-1273, BNT162b2 or Ad26.COV2.S vaccine. We demonstrated that subjects vaccinated with Ad26.COV2.S vaccine had significantly lower levels of IgG and neutralizing titers as compared to those who received the mRNA vaccines. While the linear regression analysis showed a positive correlation between IgG levels and neutralizing activities against SARS-CoV-2 WT and the variants, there was an overall reduction in neutralizing titers against the variants in subjects across the three groups. These findings suggest that people who received one dose of Ad26.COV2.S vaccine have a more limited IgG response and lower neutralization activity against SARS-CoV-2 WT and its variants than recipients of the mRNA vaccines. Thus, monitoring the plasma or serum levels of anti-SARS-CoV-2 spike IgG titer and neutralization activity is necessary for the selection of suitable vaccines, vaccine dosage and regimens.
Language	English
Publishing date	2022-05-27
Publishing country	Switzerland
Document type	Journal Article
ZDB-ID	2703319-3
ISSN	2076-393X
ISSN	2076-393X
DOI	10.3390/vaccines10060858
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Article ; Online: Defective neurite elongation and branching in Nibp/Trappc9 deficient zebrafish and mice.

International journal of biological sciences

2023 Volume 19, Issue 10, Page(s) 3226–3248

Abstract: Loss of function in transport protein particles (TRAPP) links a new set of emerging genetic disorders called "TRAPPopathies". One such disorder is NIBP syndrome, characterized by microcephaly and intellectual disability, and caused by mutations ... ...

Abstract	Loss of function in transport protein particles (TRAPP) links a new set of emerging genetic disorders called "TRAPPopathies". One such disorder is NIBP syndrome, characterized by microcephaly and intellectual disability, and caused by mutations of
MeSH term(s)	Animals ; Mice ; Intellectual Disability/genetics ; Intellectual Disability/metabolism ; Microcephaly/genetics ; Microcephaly/metabolism ; Neurites/physiology ; Neurons/metabolism ; Zebrafish
Chemical Substances	Trappc9 protein, mouse ; Trappc9 protein, zebrafish
Language	English
Publishing date	2023-06-19
Publishing country	Australia
Document type	Journal Article
ZDB-ID	2179208-2
ISSN	1449-2288 ; 1449-2288
ISSN (online)	1449-2288
ISSN	1449-2288
DOI	10.7150/ijbs.78489
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Article ; Online: Emerging role of NIK/IKK2-binding protein (NIBP)/trafficking protein particle complex 9 (TRAPPC9) in nervous system diseases.

Bodnar, Brittany / DeGruttola, Arianna / Zhu, Yuanjun / Lin, Yuan / Zhang, Yonggang / Mo, Xianming / Hu, Wenhui

Translational research : the journal of laboratory and clinical medicine

2020 Volume 224, Page(s) 55–70

Abstract: NFκB signaling and protein trafficking network play important roles in various biological and pathological processes. NIK-and-IKK2-binding protein (NIBP), also known as trafficking protein particle complex 9 (TRAPPC9), is a prototype member of a novel ... ...

Abstract	NFκB signaling and protein trafficking network play important roles in various biological and pathological processes. NIK-and-IKK2-binding protein (NIBP), also known as trafficking protein particle complex 9 (TRAPPC9), is a prototype member of a novel protein family, and has been shown to regulate both NFκB signaling pathway and protein transport/trafficking. NIBP is extensively expressed in the nervous system and plays an important role in regulating neurogenesis and neuronal differentiation. NIBP/TRAPPC9 mutations have been linked to an autosomal recessive intellectual disability syndrome, called NIBP Syndrome, which is characterized by nonsyndromic autosomal recessive intellectual disability along with other symptoms such as obesity, microcephaly, and facial dysmorphia. As more cases of NIBP Syndrome are identified, new light is being shed on the role of NIBP/TRAPPC9 in the central nervous system developments and diseases. NIBP is also involved in the enteric nervous system. This review will highlight the importance of NIBP/TRAPPC9 in central and enteric nervous system diseases, and the established possible mechanisms for developing a potential therapeutic.
MeSH term(s)	Animals ; Enteric Nervous System/pathology ; Humans ; Intercellular Signaling Peptides and Proteins/metabolism ; NF-kappa B/metabolism ; Nervous System Diseases/metabolism ; Protein Transport ; Signal Transduction
Chemical Substances	Intercellular Signaling Peptides and Proteins ; NF-kappa B
Language	English
Publishing date	2020-05-17
Publishing country	United States
Document type	Journal Article ; Research Support, N.I.H., Extramural ; Review
ZDB-ID	2246684-8
ISSN	1878-1810 ; 1532-6543 ; 1931-5244
ISSN (online)	1878-1810 ; 1532-6543
ISSN	1931-5244
DOI	10.1016/j.trsl.2020.05.001
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Ud II Zs 42: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

To top

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

Full text online

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

Order via subito

More links

Kategorien

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito