LIVIVO - Search results -

Search results

Result 1 - 10 of total 14

Article: CHAPERON

Yekeen, Abeeb Abiodun / Durojaye, Olanrewaju Ayodeji / Idris, Mukhtar Oluwaseun / Muritala, Hamdalat Folake / Arise, Rotimi Olusanya

Computational and structural biotechnology journal

2023 Volume 21, Page(s) 4849–4858

Abstract: Molecular dynamics (MD) simulation is a powerful computational tool used in biomolecular studies to investigate the dynamics, energetics, and interactions of a wide range of biological systems at the atomic level. GROMACS is a widely used free and open- ... ...

Abstract	Molecular dynamics (MD) simulation is a powerful computational tool used in biomolecular studies to investigate the dynamics, energetics, and interactions of a wide range of biological systems at the atomic level. GROMACS is a widely used free and open-source biomolecular MD simulation software recognized for its efficiency, accuracy, and extensive range of simulation options. However, the complexity of setting up, running, and analyzing MD simulations for diverse systems often poses a significant challenge, requiring considerable time, effort, and expertise. Here, we introduce CHAPERON
Language	English
Publishing date	2023-09-28
Publishing country	Netherlands
Document type	Journal Article
ZDB-ID	2694435-2
ISSN	2001-0370
ISSN	2001-0370
DOI	10.1016/j.csbj.2023.09.024
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

Article ; Online: Investigation of the MDM2-binding potential of de novo designed peptides using enhanced sampling simulations.

Durojaye, Olanrewaju Ayodeji / Yekeen, Abeeb Abiodun / Idris, Mukhtar Oluwaseun / Okoro, Nkwachukwu Oziamara / Odiba, Arome Solomon / Nwanguma, Bennett Chima

International journal of biological macromolecules

2024 , Page(s) 131840

Abstract: The tumor suppressor p53 plays a crucial role in cellular responses to various stresses, regulating key processes such as apoptosis, senescence, and DNA repair. Dysfunctional p53, prevalent in approximately 50 % of human cancers, contributes to tumor ... ...

Abstract	The tumor suppressor p53 plays a crucial role in cellular responses to various stresses, regulating key processes such as apoptosis, senescence, and DNA repair. Dysfunctional p53, prevalent in approximately 50 % of human cancers, contributes to tumor development and resistance to treatment. This study employed deep learning-based protein design and structure prediction methods to identify novel high-affinity peptide binders (Pep1 and Pep2) targeting MDM2, with the aim of disrupting its interaction with p53. Extensive all-atom molecular dynamics simulations highlighted the stability of the designed peptide in complex with the target, supported by several structural analyses, including RMSD, RMSF, Rg, SASA, PCA, and free energy landscapes. Using the steered molecular dynamics and umbrella sampling simulations, we elucidate the dissociation dynamics of p53, Pep1, and Pep2 from MDM2. Notable differences in interaction profiles were observed, emphasizing the distinct dissociation patterns of each peptide. In conclusion, the results of our umbrella sampling simulations suggest Pep1 as a higher-affinity MDM2 binder compared to p53 and Pep2, positioning it as a potential inhibitor of the MDM2-p53 interaction. Using state-of-the-art protein design tools and advanced MD simulations, this study provides a comprehensive framework for rational in silico design of peptide binders with therapeutic implications in disrupting MDM2-p53 interactions for anticancer interventions.
Language	English
Publishing date	2024-04-26
Publishing country	Netherlands
Document type	Journal Article
ZDB-ID	282732-3
ISSN	1879-0003 ; 0141-8130
ISSN (online)	1879-0003
ISSN	0141-8130
DOI	10.1016/j.ijbiomac.2024.131840
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.B 2374: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Computer-aided screening for potential TMPRSS2 inhibitors: a combination of pharmacophore modeling, molecular docking and molecular dynamics simulation approaches.

Idris, Mukhtar Oluwaseun / Yekeen, Abeeb Abiodun / Alakanse, Oluwaseun Suleiman / Durojaye, Olanrewaju Ayodeji

Journal of biomolecular structure & dynamics

2020 Volume 39, Issue 15, Page(s) 5638–5656

Abstract: Transmembrane serine protease 2 (TMPRSS2) has been established as one of the host proteins that facilitate entry of coronaviruses into host cells. One of the approaches often employed towards preventing the entry and proliferation of viruses is computer- ... ...

Abstract	Transmembrane serine protease 2 (TMPRSS2) has been established as one of the host proteins that facilitate entry of coronaviruses into host cells. One of the approaches often employed towards preventing the entry and proliferation of viruses is computer-aided inhibition studies to identify potent compounds that can inhibit activity of viral targets in the host through binding at the active site. In this study, we developed a pharmacophore model of reportedly potent drugs against severe acute respiratory syndrome coronaviruses 1 and 2 (SARS-CoV-1 and -2). The model was used to screen the ZINC database for commercially available compounds having similar features with the experimentally tested drugs. The top 3000 compounds retrieved were docked into the active sites of a homology-modelled TMPRSS2. Docking scores of the top binders were validated and the top-ranked compounds were subjected to ADME, Lipinski's and medicinal Chemistry property predictions for druglikeness analyses. Two lead compounds, ZINC64606047 and ZINC05296775, were identified having binding affinities higher than those of the reference inhibitors, favorable interactions with TMPRSS2 active site residues and good ADME and medicinal chemistry properties. Molecular dynamics simulation was used to assess the stability and dynamics of the interactions of these compounds with TMPRSS2. Binding free energy and contribution energy evaluations were determined using MMPBSA method. Analyses of the trajectory dynamics collectively established further that the lead compounds bound and interacted stably with active site residues of TMPRSS2. Nonetheless, experimental studies are needed to further assess the potentials of these compounds as possible therapeutics against coronaviruses.Communicated by Ramaswamy H. Sarma.
MeSH term(s)	Antiviral Agents/pharmacology ; COVID-19 ; Computers ; Humans ; Molecular Docking Simulation ; Molecular Dynamics Simulation ; Serine Endopeptidases
Chemical Substances	Antiviral Agents ; Serine Endopeptidases (EC 3.4.21.-) ; TMPRSS2 protein, human (EC 3.4.21.-)
Keywords	covid19
Language	English
Publishing date	2020-07-16
Publishing country	England
Document type	Journal Article
ZDB-ID	49157-3
ISSN	1538-0254 ; 0739-1102
ISSN (online)	1538-0254
ISSN	0739-1102
DOI	10.1080/07391102.2020.1792346
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 2093: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (1.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article: Molecular dynamics, quantum mechanics and docking studies of some Keap1 inhibitors - An insight into the atomistic mechanisms of their antioxidant potential.

Adelusi, Temitope Isaac / Abdul-Hammed, Misbaudeen / Idris, Mukhtar Oluwaseun / Oyedele, Qudus Kehinde / Adedotun, Ibrahim Olaide

Heliyon

2021 Volume 7, Issue 6, Page(s) e07317

Abstract: Inhibitors of Keap1 would disrupt the covalent interaction between Keap1 and Nrf2 to unleash Nrf2 transcriptional machinery that orchestrates its cellular antioxidant, cytoprotective and detoxification processes thereby, protecting the cells against ... ...

Abstract	Inhibitors of Keap1 would disrupt the covalent interaction between Keap1 and Nrf2 to unleash Nrf2 transcriptional machinery that orchestrates its cellular antioxidant, cytoprotective and detoxification processes thereby, protecting the cells against oxidative stress mediated diseases. In this
Language	English
Publishing date	2021-06-16
Publishing country	England
Document type	Journal Article
ZDB-ID	2835763-2
ISSN	2405-8440
ISSN	2405-8440
DOI	10.1016/j.heliyon.2021.e07317
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Article: Identification of a Potential mRNA-based Vaccine Candidate against the SARS-CoV-2 Spike Glycoprotein: A Reverse Vaccinology Approach.

Durojaye, Olanrewaju Ayodeji / Sedzro, Divine Mensah / Idris, Mukhtar Oluwaseun / Yekeen, Abeeb Abiodun / Fadahunsi, Adeola Abraham / Alakanse, Oluwaseun Suleiman

ChemistrySelect

2022 Volume 7, Issue 7, Page(s) e202103903

Abstract: The emergence of the novel coronavirus (SARS-CoV-2) in December 2019 has generated a devastating global consequence which makes the development of a rapidly deployable, effective and safe vaccine candidate an imminent global health priority. The design ... ...

Abstract	The emergence of the novel coronavirus (SARS-CoV-2) in December 2019 has generated a devastating global consequence which makes the development of a rapidly deployable, effective and safe vaccine candidate an imminent global health priority. The design of most vaccine candidates has been directed at the induction of antibody responses against the trimeric spike glycoprotein of SARS-CoV-2, a class I fusion protein that aids ACE2 (angiotensin-converting enzyme 2) receptor binding. A variety of formulations and vaccinology approaches are being pursued for targeting the spike glycoprotein, including simian and human replication-defective adenoviral vaccines, subunit protein vaccines, nucleic acid vaccines and whole-inactivated SARS-CoV-2. Here, we directed a reverse vaccinology approach towards the design of a nucleic acid (mRNA-based) vaccine candidate. The "YLQPRTFLL" peptide sequence (position 269-277) which was predicted to be a B cell epitope and likewise a strong binder of the HLA*A-0201 was selected for the design of the vaccine candidate, having satisfied series of antigenicity assessments. Through the codon optimization protocol, the nucleotide sequence for the vaccine candidate design was generated and targeted at the human toll-like receptor 7 (TLR7). Bioinformatics analyses showed that the sequence "UACCUGCAGCCGCGUACCUUCCUGCUG" exhibited a strong affinity and likewise was bound to a stable cavity in the TLR7 pocket. This study is therefore expected to contribute to the research efforts directed at securing definitive preventive measures against the SARS-CoV-2 infection.
Language	English
Publishing date	2022-02-17
Publishing country	Germany
Document type	Journal Article
ISSN	2365-6549
ISSN	2365-6549
DOI	10.1002/slct.202103903
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Article ; Online: ZBTB7A regulates primed-to-naïve transition of pluripotent stem cells via recognition of the PNT-associated sequence by zinc fingers 1-2 and recognition of γ-globin -200 gene element by zinc fingers 1-4.

Yang, Yang / Xiao, Lizhan / Xue, Yanting / Idris, Mukhtar Oluwaseun / Liu, Jing / Pei, Duanqing / Shi, Yunyu / Liao, Baojian / Li, Fudong

The FEBS journal

2023 Volume 290, Issue 15, Page(s) 3896–3909

Abstract: ZBTB7A, a transcription factor containing a tandem array of four Cys2-His2 zinc fingers (ZFs), is vital for multiple physiological events through directional binding to different genomic loci. Our previously determined crystal structure of ZBTB7A in ... ...

Abstract	ZBTB7A, a transcription factor containing a tandem array of four Cys2-His2 zinc fingers (ZFs), is vital for multiple physiological events through directional binding to different genomic loci. Our previously determined crystal structure of ZBTB7A in complex with a GCCCCTTCCCC sequence revealed that all four ZFs (ZF1-4) are involved in binding to γ-globin -200 gene element to repress fetal haemoglobin expression. Recently, it has been reported that ZBTB7A drives primed-to-naïve transition (PNT) of pluripotent stem cells through binding to a 12-bp consensus sequence ([AAGGACCCAGAT], referred to as PNT-associated sequence). Here, we report a crystal structure of ZBTB7A ZF1-3 in complex with the PNT-associated sequence. The structure shows that ZF1 and ZF2 primarily contribute to recognizing the GACCC core sequence mimicking the half part (GCCCC) of γ-globin -200 gene element via specific hydrogen bonding and van der Waals contacts. The mutations of key residues in ZF1-2 remarkably reduce their binding affinities for the PNT-associated sequence in vitro and cannot restore epiblast stem cells to the naïve pluripotent state in vivo. Collectively, our studies demonstrate that ZBTB7A mainly employs its ZF1-2 to recognize the PNT-associated sequence but recognizes γ-globin -200 gene element via ZF1-4, providing insights into the molecular mechanism for the diversity of ZBTB7A's genomic localization.
MeSH term(s)	DNA-Binding Proteins/genetics ; Transcription Factors/metabolism ; gamma-Globins/genetics ; Cell Line, Tumor ; Amino Acid Sequence ; Zinc Fingers/genetics ; Pluripotent Stem Cells/metabolism
Chemical Substances	DNA-Binding Proteins ; Transcription Factors ; gamma-Globins
Language	English
Publishing date	2023-04-14
Publishing country	England
Document type	Journal Article ; Research Support, Non-U.S. Gov't
ZDB-ID	2173655-8
ISSN	1742-4658 ; 1742-464X
ISSN (online)	1742-4658
ISSN	1742-464X
DOI	10.1111/febs.16789
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 260: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (1.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: CSC01 shows promise as a potential inhibitor of the oncogenic G13D mutant of KRAS: an in silico approach.

Durojaye, Olanrewaju Ayodeji / Ejaz, Umer / Uzoeto, Henrietta Onyinye / Fadahunsi, Adeola Abraham / Opabunmi, Adebayo Oluwole / Ekpo, Daniel Emmanuel / Sedzro, Divine Mensah / Idris, Mukhtar Oluwaseun

Amino acids

2023 Volume 55, Issue 12, Page(s) 1745–1764

Abstract: About 30% of malignant tumors include KRAS mutations, which are frequently required for the development and maintenance of malignancies. KRAS is now a top-priority cancer target as a result. After years of research, it is now understood that the ... ...

Abstract	About 30% of malignant tumors include KRAS mutations, which are frequently required for the development and maintenance of malignancies. KRAS is now a top-priority cancer target as a result. After years of research, it is now understood that the oncogenic KRAS-G12C can be targeted. However, many other forms, such as the G13D mutant, are yet to be addressed. Here, we used a receptor-based pharmacophore modeling technique to generate potential inhibitors of the KRAS-G13D oncogenic mutant. Using a comprehensive virtual screening workflow model, top hits were selected, out of which CSC01 was identified as a promising inhibitor of the oncogenic KRAS mutant (G13D). The stability of CSC01 upon binding the switch II pocket was evaluated through an exhaustive molecular dynamics simulation study. The several post-simulation analyses conducted suggest that CSC01 formed a stable complex with KRAS-G13D. CSC01, through a dynamic protein-ligand interaction profiling analysis, was also shown to maintain strong interactions with the mutated aspartic acid residue throughout the simulation. Although binding free energy analysis through the umbrella sampling approach suggested that the affinity of CSC01 with the switch II pocket of KRAS-G13D is moderate, our DFT analysis showed that the stable interaction of the compound might be facilitated by the existence of favorable molecular electrostatic potentials. Furthermore, based on ADMET predictions, CSC01 demonstrated a satisfactory drug likeness and toxicity profile, making it an exemplary candidate for consideration as a potential KRAS-G13D inhibitor.
MeSH term(s)	Humans ; Proto-Oncogene Proteins p21(ras)/genetics ; Colorectal Neoplasms/pathology ; Mutation ; Molecular Dynamics Simulation
Chemical Substances	Proto-Oncogene Proteins p21(ras) (EC 3.6.5.2) ; KRAS protein, human
Language	English
Publishing date	2023-07-27
Publishing country	Austria
Document type	Journal Article
ZDB-ID	1121341-3
ISSN	1438-2199 ; 0939-4451
ISSN (online)	1438-2199
ISSN	0939-4451
DOI	10.1007/s00726-023-03304-2
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 3490: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (2.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: ZBTB7A regulates primed‐to‐naïve transition of pluripotent stem cells via recognition of the PNT‐associated sequence by zinc fingers 1–2 and recognition of γ‐globin −200 gene element by zinc fingers 1–4

Yang, Yang / Xiao, Lizhan / Xue, Yanting / Idris, Mukhtar Oluwaseun / Liu, Jing / Pei, Duanqing / Shi, Yunyu / Liao, Baojian / Li, Fudong

The FEBS Journal. 2023 Aug., v. 290, no. 15 p.3896-3909

2023

Abstract: ZBTB7A, a transcription factor containing a tandem array of four Cys2‐His2 zinc fingers (ZFs), is vital for multiple physiological events through directional binding to different genomic loci. Our previously determined crystal structure of ZBTB7A in ... ...

Abstract	ZBTB7A, a transcription factor containing a tandem array of four Cys2‐His2 zinc fingers (ZFs), is vital for multiple physiological events through directional binding to different genomic loci. Our previously determined crystal structure of ZBTB7A in complex with a GCCCCTTCCCC sequence revealed that all four ZFs (ZF1–4) are involved in binding to γ‐globin −200 gene element to repress fetal haemoglobin expression. Recently, it has been reported that ZBTB7A drives primed‐to‐naïve transition (PNT) of pluripotent stem cells through binding to a 12‐bp consensus sequence ([AAGGACCCAGAT], referred to as PNT‐associated sequence). Here, we report a crystal structure of ZBTB7A ZF1–3 in complex with the PNT‐associated sequence. The structure shows that ZF1 and ZF2 primarily contribute to recognizing the GACCC core sequence mimicking the half part (GCCCC) of γ‐globin −200 gene element via specific hydrogen bonding and van der Waals contacts. The mutations of key residues in ZF1–2 remarkably reduce their binding affinities for the PNT‐associated sequence in vitro and cannot restore epiblast stem cells to the naïve pluripotent state in vivo. Collectively, our studies demonstrate that ZBTB7A mainly employs its ZF1–2 to recognize the PNT‐associated sequence but recognizes γ‐globin −200 gene element via ZF1–4, providing insights into the molecular mechanism for the diversity of ZBTB7A's genomic localization.
Keywords	consensus sequence ; crystal structure ; embryonic germ layers ; genes ; genomics ; hemoglobin ; hydrogen ; transcription factors ; van der Waals forces ; zinc
Language	English
Dates of publication	2023-08
Size	p. 3896-3909.
Publishing place	John Wiley & Sons, Ltd
Document type	Article ; Online
Note	JOURNAL ARTICLE
ZDB-ID	2173655-8
ISSN	1742-4658 ; 1742-464X
ISSN (online)	1742-4658
ISSN	1742-464X
DOI	10.1111/febs.16789
Database	NAL-Catalogue (AGRICOLA)

In stock of ZB MED Bonn / Germany

Z 2006/704: Show issues

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

Article: Computer-aided screening for potential TMPRSS2 inhibitors: a combination of pharmacophore modeling, molecular docking and molecular dynamics simulation approaches

Idris, Mukhtar Oluwaseun / Yekeen, Abeeb Abiodun / Alakanse, Oluwaseun Suleiman / Durojaye, Olanrewaju Ayodeji

J Biomol Struct Dyn

Abstract	Transmembrane serine protease 2 (TMPRSS2) has been established as one of the host proteins that facilitate entry of coronaviruses into host cells. One of the approaches often employed towards preventing the entry and proliferation of viruses is computer-aided inhibition studies to identify potent compounds that can inhibit activity of viral targets in the host through binding at the active site. In this study, we developed a pharmacophore model of reportedly potent drugs against severe acute respiratory syndrome coronaviruses 1 and 2 (SARS-CoV-1 and -2). The model was used to screen the ZINC database for commercially available compounds having similar features with the experimentally tested drugs. The top 3000 compounds retrieved were docked into the active sites of a homology-modelled TMPRSS2. Docking scores of the top binders were validated and the top-ranked compounds were subjected to ADME, Lipinski's and medicinal Chemistry property predictions for druglikeness analyses. Two lead compounds, ZINC64606047 and ZINC05296775, were identified having binding affinities higher than those of the reference inhibitors, favorable interactions with TMPRSS2 active site residues and good ADME and medicinal chemistry properties. Molecular dynamics simulation was used to assess the stability and dynamics of the interactions of these compounds with TMPRSS2. Binding free energy and contribution energy evaluations were determined using MMPBSA method. Analyses of the trajectory dynamics collectively established further that the lead compounds bound and interacted stably with active site residues of TMPRSS2. Nonetheless, experimental studies are needed to further assess the potentials of these compounds as possible therapeutics against coronaviruses. Communicated by Ramaswamy H. Sarma.
Keywords	covid19
Publisher	WHO
Document type	Article
Note	WHO #Covidence: #648328
Database	COVID19

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾

Article ; Online: Molecular dynamics, quantum mechanics and docking studies of some Keap1 inhibitors – An insight into the atomistic mechanisms of their antioxidant potential

Temitope Isaac Adelusi / Misbaudeen Abdul-Hammed / Mukhtar Oluwaseun Idris / Qudus Kehinde Oyedele / Ibrahim Olaide Adedotun

Heliyon, Vol 7, Iss 6, Pp e07317- (2021)

2021

Abstract	Inhibitors of Keap1 would disrupt the covalent interaction between Keap1 and Nrf2 to unleash Nrf2 transcriptional machinery that orchestrates its cellular antioxidant, cytoprotective and detoxification processes thereby, protecting the cells against oxidative stress mediated diseases. In this in silico research, we investigated the Keap1 inhibiting potential of fifty (50) antioxidants using pharmacokinetic ADMET profiling, bioactivity assessment, physicochemical studies, molecular docking investigation, molecular dynamics and Quantum mechanical-based Density Functional Theory (DFT) studies using Keap1 as the apoprotein control. Out of these 50 antioxidants, Maslinic acid (MASA), 18-alpha-glycyrrhetinic acid (18-AGA) and resveratrol stand out by passing the RO5 (Lipinski rule of 5) for the physicochemical properties and ADMET studies. These three compounds also show high binding affinity of -10.6 kJ/mol, -10.4 kJ/mol and -7.8 kJ/mol at the kelch pocket of Keap1 respectively. Analysis of the 20ns trajectories using RMSD, RMSF, ROG and h-bond parameters revealed the stability of these compounds after comparing them with Keap1 apoprotein. Furthermore, the electron donating and accepting potentials of these compounds was used to investigate their reactivity using Density Functional Theory (HOMO and LUMO) and it was revealed that resveratrol had the highest stability based on its low energy gap. Our results predict that the three compounds are potential drug candidates with domiciled therapeutic functions against oxidative stress-mediated diseases. However, resveratrol stands out as the compound with the best stability and therefore, could be the best candidate with the best therapeutic efficacy.
Keywords	Molecular dynamics ; Molecular docking ; Density functional theory ; Keap1 ; Science (General) ; Q1-390 ; Social sciences (General) ; H1-99
Subject code	540
Language	English
Publishing date	2021-06-01T00:00:00Z
Publisher	Elsevier
Document type	Article ; Online
Database	BASE - Bielefeld Academic Search Engine (life sciences selection)

Full text online

Full text

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

To top

More links

Kategorien

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

Order via subito

More links

Kategorien

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED

Kategorien

Inter-library loan at ZB MED

Full text online

More links

Kategorien

Inter-library loan at ZB MED