LIVIVO - The Search Portal for Life Sciences

zur deutschen Oberfläche wechseln
Advanced search

Search results

Result 1 - 9 of total 9

Search options

  1. Article: Factual insights of the allosteric inhibition mechanism of SARS-CoV-2 main protease by quercetin: an in silico analysis.

    Verma, Shalja / Pandey, Anand Kumar

    3 Biotech

    2021  Volume 11, Issue 2, Page(s) 67

    Abstract: SARS-CoV-2 main protease ( ... ...

    Abstract SARS-CoV-2 main protease (M
    Language English
    Publishing date 2021-01-12
    Publishing country Germany
    Document type Journal Article
    ZDB-ID 2600522-0
    ISSN 2190-5738 ; 2190-572X
    ISSN (online) 2190-5738
    ISSN 2190-572X
    DOI 10.1007/s13205-020-02630-6
    Database MEDical Literature Analysis and Retrieval System OnLINE

    Full text online

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  2. Article ; Online: In silico

    Pandey, Anand Kumar / Verma, Shalja

    Drug development and industrial pharmacy

    2022  Volume 48, Issue 10, Page(s) 539–551

    Abstract: Spike glycoprotein of severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) binds angiotensin-converting enzyme-2 (ACE-2) receptors via its receptor-binding domain (RBD) and mediates virus-to-host cell fusion. Recently emerged omicron variant of ... ...

    Abstract Spike glycoprotein of severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) binds angiotensin-converting enzyme-2 (ACE-2) receptors via its receptor-binding domain (RBD) and mediates virus-to-host cell fusion. Recently emerged omicron variant of SARS-CoV-2 possesses around 30 mutations in spike protein where N501Y tremendously increases viral infectivity and transmission. Lectins interact with glycoproteins and mediate innate immunity displaying antiviral, antibacterial, and anticarcinogenic properties. In this study, we analyzed the potential of lectin, and lectin-antibody (spike-specific) complex to inhibit the ACE-2 binding site of wild and N501Y mutated spike protein by utilizing
    MeSH term(s) Humans ; Spike Glycoprotein, Coronavirus/metabolism ; SARS-CoV-2 ; COVID-19/drug therapy ; Antiviral Agents/pharmacology ; Lectins/metabolism ; Molecular Docking Simulation ; Viral Envelope Proteins/genetics ; Viral Envelope Proteins/metabolism ; Membrane Glycoproteins/genetics ; Membrane Glycoproteins/metabolism ; Protein Structure, Tertiary ; Binding Sites ; Protein Binding ; Antibodies/metabolism
    Chemical Substances spike protein, SARS-CoV-2 ; Spike Glycoprotein, Coronavirus ; Antiviral Agents ; Lectins ; Viral Envelope Proteins ; Membrane Glycoproteins ; Antibodies
    Language English
    Publishing date 2022-10-27
    Publishing country England
    Document type Journal Article
    ZDB-ID 751874-2
    ISSN 1520-5762 ; 0363-9045
    ISSN (online) 1520-5762
    ISSN 0363-9045
    DOI 10.1080/03639045.2022.2137196
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 1335: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (1.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  3. Article ; Online: An in silico analysis of effective siRNAs against COVID-19 by targeting the leader sequence of SARS-CoV-2.

    Pandey, Anand Kumar / Verma, Shalja

    Advances in cell and gene therapy

    2021  Volume 4, Issue 2, Page(s) e107

    Abstract: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is a retrovirus having genome size of around 30 kb. Its genome contains a highly conserved leader sequence at its 5' end, which is added to all subgenomic mRNAs at their 5' terminus by a ... ...

    Abstract Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is a retrovirus having genome size of around 30 kb. Its genome contains a highly conserved leader sequence at its 5' end, which is added to all subgenomic mRNAs at their 5' terminus by a discontinuous transcription mechanism and regulates their translation. Targeting the leader sequence by RNA interference can be an effective approach to inhibit the viral replication. In the present study an in-silico prediction of highly effective siRNAs was performed to target the leader sequence using the online software siDirect version 2.0. Low seed-duplex stability, exact complementarity with target, at least three mismatches with any off-target and least number of off-targets, were considered as effective criteria for highly specific siRNA. Further validation of siRNA affinity for the target was accomplished by molecular docking by HNADOCK online server. Our results revealed four potential siRNAs, of which siRNA having guide strand sequence 5'GUUUAGAGAACAGAUCUACAA3' met almost all specificity criteria with no off-targets for guide strand. Molecular docking of all predicted siRNAs (guide strand) with the target leader sequence depicted highest binding score of -327.45 for above-mentioned siRNA. Furthermore, molecular docking of the passenger strand of the best candidate with off-target sequences gave significantly low binding scores. Hence, 5'GUUUAGAGAACAGAUCUACAA3' siRNA possess great potential to silence the leader sequence of SARS-CoV-2 with least off-target effect. Present study provides great scope for development of gene therapy against the prevailing COVID-19 disease, thus further research in this concern is urgently demanded.
    Language English
    Publishing date 2021-02-28
    Publishing country United States
    Document type Journal Article
    ISSN 2573-8461
    ISSN (online) 2573-8461
    DOI 10.1002/acg2.107
    Database MEDical Literature Analysis and Retrieval System OnLINE

    Full text online

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  4. Article ; Online: An in-silico evaluation of dietary components for structural inhibition of SARS-Cov-2 main protease.

    Pandey, Anand Kumar / Verma, Shalja

    Journal of biomolecular structure & dynamics

    2020  Volume 40, Issue 1, Page(s) 136–142

    Abstract: The main protease ( ... ...

    Abstract The main protease (M
    MeSH term(s) Antioxidants/pharmacology ; COVID-19 ; Coronavirus 3C Proteases/antagonists & inhibitors ; Diet ; Humans ; Molecular Docking Simulation ; Molecular Dynamics Simulation ; Protease Inhibitors/pharmacology ; SARS-CoV-2
    Chemical Substances Antioxidants ; Protease Inhibitors ; 3C-like proteinase, SARS-CoV-2 (EC 3.4.22.-) ; Coronavirus 3C Proteases (EC 3.4.22.28)
    Keywords covid19
    Language English
    Publishing date 2020-08-18
    Publishing country England
    Document type Journal Article
    ZDB-ID 49157-3
    ISSN 1538-0254 ; 0739-1102
    ISSN (online) 1538-0254
    ISSN 0739-1102
    DOI 10.1080/07391102.2020.1809522
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 2093: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (1.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  5. Article: Factual insights of the allosteric inhibition mechanism of SARS-CoV-2 main protease by quercetin: an in silico analysis

    Verma, Shalja / Pandey, Anand Kumar

    3 Biotech. 2021 Feb., v. 11, no. 2

    2021  

    Abstract: SARS-CoV-2 main protease (Mᵖʳᵒ) cleaves the viral polypeptide 1a and 1ab in a site-specific ((L-Q|(S, A, G)) manner and produce functional enzymes for mediating viral replication. Numerous studies have reported synthetic competitive inhibitors against ... ...

    Abstract SARS-CoV-2 main protease (Mᵖʳᵒ) cleaves the viral polypeptide 1a and 1ab in a site-specific ((L-Q|(S, A, G)) manner and produce functional enzymes for mediating viral replication. Numerous studies have reported synthetic competitive inhibitors against this target enzyme but increase in substrate concentration often reduces the effectiveness of such inhibitors. Allosteric inhibition by natural compound can provide safe and effective treatment by alleviating this limitation. Present study deals with in silico allosteric inhibition analysis of quercetin, against SARS-CoV-2-Mᵖʳᵒ. Molecular docking of quercetin with Mᵖʳᵒ revealed consistent binding of quercetin at a site other than active site in multiple runs, with the highest binding energy of − 8.31 kcal/mol, forming 6 H-bonds with residues Gln127, Cys128, Lys137, Asp289 and Glu290. Molecular dynamic simulation of 50 ns revealed high stability of Mᵖʳᵒ-quercetin complex with RMSD values ranging from 0.1 to 0.25 nm. Moreover, native-Mᵖʳᵒ and Mᵖʳᵒ-quercetin complex conformations extracted at different time points from simulation trajectories were subjected to active site-specific docking with modelled substrate peptide (AVLQSGFR) by ZDOCK server. Results displayed site-specific cleavage of peptide when docked with native-Mᵖʳᵒ. While substrate peptide remained intact when docked with Mᵖʳᵒ-quercetin complex, also the binding energy of peptide reduced from 785 to 86 from 1 to 50 ns as quercetin induced alterations in the active site cavity reducing its affinity for the substrate. Further, no interactions were noticed between peptide and active site residues of Mᵖʳᵒ-quercetin complex conformations at 40 and 50 ns. Hence, quercetin displayed effective allosteric inhibition potential against SARS-CoV-2 Mᵖʳᵒ, and can be developed into an efficient treatment for COVID-19.
    Keywords COVID-19 infection ; Severe acute respiratory syndrome coronavirus 2 ; active sites ; computer simulation ; energy ; polypeptides ; proteinases ; quercetin ; virus replication
    Language English
    Dates of publication 2021-02
    Size p. 67.
    Publishing place Springer International Publishing
    Document type Article
    Note NAL-AP-2-clean
    ZDB-ID 2600522-0
    ISSN 2190-5738 ; 2190-572X
    ISSN (online) 2190-5738
    ISSN 2190-572X
    DOI 10.1007/s13205-020-02630-6
    Database NAL-Catalogue (AGRICOLA)

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  6. Article ; Online: Combination drug therapy for multimodal treatment of cancer by targeting mitochondrial transcriptional pathway: An in-silico approach.

    Pandey, Anand Kumar / Verma, Shalja

    Medical hypotheses

    2020  Volume 143, Page(s) 110075

    Abstract: Cancer pathologies are deeply associated with mitochondrial dysfunction. TFAM, transcription factor A of mitochondria plays eminent role in transcription and replication of mtDNA to synthesize different mitochondrial proteins, has been reported to have ... ...

    Abstract Cancer pathologies are deeply associated with mitochondrial dysfunction. TFAM, transcription factor A of mitochondria plays eminent role in transcription and replication of mtDNA to synthesize different mitochondrial proteins, has been reported to have elevated levels during malignancy and can be a compelling target of the disease. We hypothesize that violacein and silver nanoparticles, as a dyad drug system, can structurally bind and inhibit TFAM at the interface of TFAM-DNA complex during replication and thus can hinder majority of pathways contributing to cancer proliferation. It is evident from our molecular docking analysis of violacein and silver nanoparticles with the TFAM-DNA complex which gave resulting negative binding energy of -8.836 kcal/mol for violacein with inhibition constant (Ki value) of 1.51 μM and high binding score of 9518 for silver nanoparticle in the DNA interacting cavity of TFAM. Hence, our hypothesis of employing violacein and silver nanoparticle for cancer treatment by TFAM inhibition seems highly promising and further in-vitro and in-vivo studies are extremely demanded in this concern.
    MeSH term(s) Combined Modality Therapy ; DNA, Mitochondrial ; DNA-Binding Proteins/genetics ; Drug Therapy, Combination ; Humans ; Metal Nanoparticles ; Mitochondrial Proteins/genetics ; Molecular Docking Simulation ; Neoplasms/drug therapy ; Neoplasms/genetics ; Silver ; Transcription Factors/genetics
    Chemical Substances DNA, Mitochondrial ; DNA-Binding Proteins ; Mitochondrial Proteins ; Transcription Factors ; Silver (3M4G523W1G)
    Language English
    Publishing date 2020-07-05
    Publishing country United States
    Document type Journal Article
    ZDB-ID 193145-3
    ISSN 1532-2777 ; 0306-9877
    ISSN (online) 1532-2777
    ISSN 0306-9877
    DOI 10.1016/j.mehy.2020.110075
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 1132: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (1.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  7. Article ; Online: Characterization of AICAR transformylase/IMP cyclohydrolase (ATIC) bifunctional enzyme from Candidatus Liberibacer asiaticus.

    Lonare, Sapna / Rode, Surabhi / Verma, Preeti / Verma, Shalja / Kaur, Harry / Alam, Md Shahid / Wangmo, Padma / Kumar, Pravindra / Roy, Partha / Sharma, Ashwani Kumar

    Biochimica et biophysica acta. Proteins and proteomics

    2024  Volume 1872, Issue 4, Page(s) 141015

    Abstract: The bifunctional enzyme, 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) transformylase/inosine monophosphate (IMP) cyclohydrolase (ATIC) is involved in catalyzing penultimate and final steps of purine de novo biosynthetic pathway crucial for the ... ...

    Abstract The bifunctional enzyme, 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) transformylase/inosine monophosphate (IMP) cyclohydrolase (ATIC) is involved in catalyzing penultimate and final steps of purine de novo biosynthetic pathway crucial for the survival of organisms. The present study reports the characterization of ATIC from Candidatus Liberibacer asiaticus (CLasATIC) along with the identification of potential inhibitor molecules and evaluation of cell proliferative activity. CLasATIC showed both the AICAR Transformylase (AICAR TFase) activity for substrates, 10-f-THF (K
    Language English
    Publishing date 2024-04-12
    Publishing country Netherlands
    Document type Journal Article
    ZDB-ID 2918798-9
    ISSN 1878-1454 ; 1570-9639
    ISSN (online) 1878-1454
    ISSN 1570-9639
    DOI 10.1016/j.bbapap.2024.141015
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 7161: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  8. Article: An in-silico evaluation of dietary components for structural inhibition of SARS-Cov-2 main protease

    Pandey, Anand Kumar / Verma, Shalja

    J Biomol Struct Dyn

    Abstract: The main protease (Mpro) of SARS-CoV-2 is responsible for the cleavage of viral replicase polyproteins 1a and 1ab into their mature form and is highly specific and exclusive in its activity. Many studies have targeted this enzyme by small molecule ... ...

    Abstract The main protease (Mpro) of SARS-CoV-2 is responsible for the cleavage of viral replicase polyproteins 1a and 1ab into their mature form and is highly specific and exclusive in its activity. Many studies have targeted this enzyme by small molecule inhibitors to develop therapeutics against the highly infectious disease Covid-19. Our diet contains many natural antioxidants which along with providing support for proper growth and functioning of the body, pose additional health benefits. Present in-silico analysis depicted that natural antioxidants like sesamin, ellagic acid, capsaisin, and epicatechin along with galangin, exhibited significant binding at the catalytic site of the Mpro enzyme. They interacted with excellent efficiency with the chief active site residue Cys145 and thus seem to possess the remarkable potential to act as drug candidates for the treatment of Covid-19. Such dietary compounds can be easily administered orally with least toxicity related concern and thus yell for urgent exhaustive research to develop into efficient therapies. Communicated by Ramaswamy H. Sarma.
    Keywords covid19
    Publisher WHO
    Document type Article
    Note WHO #Covidence: #720885
    Database COVID19

    Kategorien

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  9. Article ; Online: A molecular genetics view on Mucopolysaccharidosis Type II.

    Verma, Shalja / Pantoom, Supansa / Petters, Janine / Pandey, Anand Kumar / Hermann, Andreas / Lukas, Jan

    Mutation research. Reviews in mutation research

    2021  Volume 788, Page(s) 108392

    Abstract: Mucopolysaccharidosis Type II (MPS II) is an X-linked recessive genetic disorder that primarily affects male patients. With an incidence of 1 in 100,000 male live births, the disease is one of the orphan diseases. MPS II symptoms are caused by mutations ... ...

    Abstract Mucopolysaccharidosis Type II (MPS II) is an X-linked recessive genetic disorder that primarily affects male patients. With an incidence of 1 in 100,000 male live births, the disease is one of the orphan diseases. MPS II symptoms are caused by mutations in the lysosomal iduronate-2-sulfatase (IDS) gene. The mutations cause a loss of enzymatic performance and result in the accumulation of glycosaminoglycans (GAGs), heparan sulfate and dermatan sulfate, which are no longer degradable. This inadvertent accumulation causes damage in multiple organs and leads either to a severe neurological course or to an attenuated course of the disease, although the exact relationship between mutation, extent of GAG accumulation and disease progression is not yet fully understood. This review is intended to present current diagnostic procedures and therapeutic interventions. In times when the genetic profile of patients plays an increasingly important role in the assessment of therapeutic success and future drug design, we chose to further elucidate the impact of genetic diversity within the IDS gene on disease phenotype and potential implications in current diagnosis, prognosis and therapy. We report recent advances in the structural biological elucidation of I2S enzyme that that promises to improve our future understanding of the molecular damage of the hundreds of IDS gene variants and will aid damage prediction of novel mutations in the future.
    MeSH term(s) Animals ; Glycoproteins/chemistry ; Glycoproteins/genetics ; Glycoproteins/metabolism ; Humans ; Mucopolysaccharidosis II/drug therapy ; Mucopolysaccharidosis II/genetics ; Mucopolysaccharidosis II/metabolism ; Mutation ; Phenotype
    Chemical Substances Glycoproteins ; IDS protein, human
    Language English
    Publishing date 2021-08-08
    Publishing country Netherlands
    Document type Journal Article ; Research Support, Non-U.S. Gov't ; Review
    ZDB-ID 2727833-5
    ISSN 1388-2139 ; 1383-5742
    ISSN (online) 1388-2139
    ISSN 1383-5742
    DOI 10.1016/j.mrrev.2021.108392
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 1316 -Rev-: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (1.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

To top