LIVIVO - The Search Portal for Life Sciences

zur deutschen Oberfläche wechseln
Advanced search

Search results

Result 1 - 10 of total 17487

Search options

  1. Book ; Online ; E-Book: Molecular mechanisms of nutritional interventions and supplements for the management of sexual dysfunction and benign prostatic hyperplasia

    Chughtai, Bilal

    2021  

    Author's details edited by Bilal Chughtai
    Keywords Benign prostatic hyperplasia/Treatment
    Subject code 616.65
    Language English
    Size 1 online resource (241 pages)
    Publisher Academic Press
    Publishing place London, England
    Document type Book ; Online ; E-Book
    Remark Zugriff für angemeldete ZB MED-Nutzerinnen und -Nutzer
    ISBN 0-12-822602-1 ; 0-12-819765-X ; 978-0-12-822602-5 ; 978-0-12-819765-3
    Database ZB MED Catalogue: Medicine, Health, Nutrition, Environment, Agriculture

    Full text online

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  2. Book ; Thesis: Safety and efficacy of stereotactic procedures using an intraoperative magnetic resonance-scanner

    Younes, Bilal

    analysis of 500 consecutive cases and comparison with alternative imaging workflows

    2020  

    Author's details vorgelegt von Bilal Younes
    Language English
    Size 101 Blätter, Illustrationen, Diagramme, 30 cm
    Publishing place Heidelberg
    Publishing country Germany
    Document type Book ; Thesis
    Thesis / German Habilitation thesis Dissertation, Ruprecht-Karls-Universität Heidelberg, 2020
    HBZ-ID HT020994180
    Database Catalogue ZB MED Medicine, Health

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Shelf markLoan statusLocation
    2021 E 826 order for loan Magazin

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  3. Book ; Online: Abū Manṣūr al-Tha᾽ālibī : Kitāb Khāṣṣ al-Khāṣṣ

    Orfali, Bilal / Baalbaki, Ramzi

    2021  

    Keywords Islam ; Islamic theology ; Islamic studies ; Poetry ; proverbs ; 11th century ; araic
    Size 1 electronic resource (324 pages)
    Publisher De Gruyter
    Publishing place Berlin/Boston
    Document type Book ; Online
    Note Arabic ; Open Access
    HBZ-ID HT021231000
    ISBN 9783110688894 ; 3110688891
    Database ZB MED Catalogue: Medicine, Health, Nutrition, Environment, Agriculture

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  4. Book ; Online ; E-Book: Food biopolymers

    Gani, Adil / Ashwar, Bilal Ahmad

    structural, functional and nutraceutical properties

    2021  

    Abstract: Food biopolymers: Structural, functional and nutraceutical properties provides valuable coverage of all major food biopolymers of from plant, animal and marine sources. The text focuses on the structural characteristics of biopolymers including starch, ... ...

    Author's details Adil Gani, Bilal Ahmad Ashwar, editors
    Abstract Food biopolymers: Structural, functional and nutraceutical properties provides valuable coverage of all major food biopolymers of from plant, animal and marine sources. The text focuses on the structural characteristics of biopolymers including starch, non-starch polysaccharides, proteins and fats. A full section is dedicated to the nutraceutical potential and applications of these polymers. Further sections provide comprehensive overviews of the development of functional food products and important data on biopolymer behavior and nutraceutical potential during processing. Researchers hoping to gain a basic understanding of the techno-functional, nutraceutical potential and applications of food biopolymers will find a singular source with this text. The first section of this work focuses on the the structure, functions, bioactivity and applications of starches. The next chapters cover non-starch polysaccharides. Further sections are dedicated to proteins, lipids and oils. A detailed overview is provided for each, followed by application procedures, specifics on individual types, proteins and enzymes, and nutraceutical properties. This work can be used as a singular source for all relevant information on food biopolymers and their structural and functional properties, including their potential to increase food quality, improve shelf life, and reduce pollution and waste in the food industry. .
    Keywords Food/Biotechnology
    Subject code 664
    Language English
    Size 1 online resource (VI, 441 p. 47 illus., 21 illus. in color.)
    Edition 1st ed. 2021.
    Publisher Springer
    Publishing place Cham, Switzerland
    Document type Book ; Online ; E-Book
    Remark Zugriff für angemeldete ZB MED-Nutzerinnen und -Nutzer
    ISBN 3-030-27061-0 ; 3-030-27060-2 ; 978-3-030-27061-2 ; 978-3-030-27060-5
    DOI 10.1007/978-3-030-27061-2
    Database ZB MED Catalogue: Medicine, Health, Nutrition, Environment, Agriculture

    Full text online

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  5. Book ; Online ; E-Book: Advanced skin cancer

    Sahni, Debjani / Lerner, Adam / Fawaz, Bilal

    a case-based approach

    2022  

    Author's details senior editors Debjani Sahni, Adam Lerner. Junior editor Bilal Fawaz
    Keywords Skin/Cancer
    Subject code 616.99477
    Language English
    Size 1 Online-Ressource (xiii, 174 Seiten), Illustrationen
    Edition First edition
    Publisher CRC Press
    Publishing place Boca Raton
    Publishing country United States
    Document type Book ; Online ; E-Book
    Remark Zugriff für angemeldete ZB MED-Nutzerinnen und -Nutzer
    HBZ-ID HT021284801
    ISBN 978-0-429-65162-5 ; 978-0-429-64898-4 ; 978-0-429-02668-3 ; 9780367134716 ; 9781032230245 ; 0-429-65162-7 ; 0-429-64898-7 ; 0-429-02668-4 ; 0367134713 ; 103223024X
    Database ZB MED Catalogue: Medicine, Health, Nutrition, Environment, Agriculture

    Full text online

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  6. Book ; Online ; E-Book: Microbial biomolecules

    Kumar, Ajay / Bilal, Muhammad / Ferreira, Luiz Fernando Romanholo / Kumari, Madhuree

    emerging approach in agriculture, pharmaceuticals and environment management

    (Developments in applied microbiology and biotechnology)

    2023  

    Author's details edited by Ajay Kumar, Muhammad Bilal, Luiz Fernando Romanholo Ferreira, Madhuree Kumari
    Series title Developments in applied microbiology and biotechnology
    MeSH term(s) Biodegradation, Environmental ; Biotechnology.
    Keywords Agricultural biotechnology ; Biomolecules ; Bioremediation
    Subject code 338.16
    Language English
    Size 1 online resource (540 pages) :, illustrations
    Publisher Academic Press is an imprint of Elsevier
    Publishing place London
    Document type Book ; Online ; E-Book
    Remark Zugriff für angemeldete ZB MED-Nutzerinnen und -Nutzer
    ISBN 0-323-95850-8 ; 9780323994767 ; 978-0-323-95850-9 ; 0323994768
    Database ZB MED Catalogue: Medicine, Health, Nutrition, Environment, Agriculture

    Full text online

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  7. Book ; Online: New Frontiers in Materials Design for Laser Additive Manufacturing

    Gökce, Bilal / Jägle, Eric / Schmid, Manfred

    2022  

    Keywords Technology: general issues ; Chemical engineering ; powder bed fusion ; magnesium ; process development ; additive manufacturing ; PBF-LB/M ; tool steel (1.2709) ; nanocomposite ; microstructure ; mechanical properties ; laser powder bed fusion ; selective laser melting ; oxide dispersion strengthened steel ; phase-field model ; finite element simulation ; nanoparticle interaction ; pure copper ; short wavelength laser system ; green laser ; eddy-current method ; electrical conductivity ; polyamide 12 ; nanocomposites ; nanoparticles ; dispersion ; LB-PBF ; additively manufactured parts ; aluminum alloys ; intermetallics ; thermal exposure ; n/a ; aluminium alloys ; hot cracking ; rapid solidification ; differential fast scanning calorimetry ; undercooling ; grain size ; crack density
    Language English
    Size 1 electronic resource (136 pages)
    Publisher MDPI - Multidisciplinary Digital Publishing Institute
    Publishing place Basel
    Document type Book ; Online
    Note English
    HBZ-ID HT030383242
    ISBN 9783036558820 ; 3036558829
    Database ZB MED Catalogue: Medicine, Health, Nutrition, Environment, Agriculture

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  8. Article: A Case Report of Recurrent Pneumothorax: A Rare Complication of Tricuspid Valve Endocarditis.

    Bilal, Muhammad

    Cureus

    2023  Volume 15, Issue 10, Page(s) e46995

    Abstract: Intravenous drug use (IVDU) is a recognized risk factor for infective endocarditis (IE), with potential mechanisms involving direct bacterial introduction through the needle puncture. Bilateral pneumothorax, an under-reported yet significant complication ...

    Abstract Intravenous drug use (IVDU) is a recognized risk factor for infective endocarditis (IE), with potential mechanisms involving direct bacterial introduction through the needle puncture. Bilateral pneumothorax, an under-reported yet significant complication of IE, was first documented in 1990. Only eleven cases of spontaneous pneumothorax (PTX) associated with septic pulmonary embolism from IE have been reported. We present a 26-year-old female with a history of IE and a prior pneumothorax. She was transferred to our facility for recurrent IE, confirmed by echocardiography and blood cultures. After an initial stable clinical course, on the fifth morning, she developed new-onset dyspnea, later diagnosed with bilateral PTX that required bilateral chest tube placement. Left-sided PTX resolved quickly, while the right-sided PTX persisted for 11 more days. Following clinical improvement, the patient was discharged on the 18th day. Promptly identifying this rare complication was crucial for the patient's survival.
    Language English
    Publishing date 2023-10-13
    Publishing country United States
    Document type Case Reports
    ZDB-ID 2747273-5
    ISSN 2168-8184
    ISSN 2168-8184
    DOI 10.7759/cureus.46995
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  9. Book ; Online ; E-Book: Antibiotika in der Zahnmedizin

    Al-Nawas, Bilal / Eickholz, Peter / Hülsmann, Michael

    2021  

    Author's details Bilal Al-Nawas, Peter Eickholz, Michael Hülsmann
    Keywords Electronic books
    Language German
    Size 1 Online-Ressource (356 Seiten), Illustrationen, Diagramme
    Publisher Quintessenz Publishing
    Publishing place Berlin
    Publishing country Germany
    Document type Book ; Online ; E-Book
    Remark Zugriff für angemeldete ZB MED-Nutzerinnen und -Nutzer
    HBZ-ID HT020914537
    ISBN 978-3-86867-553-5 ; 9783868675528 ; 3-86867-553-1 ; 3868675523
    Database ZB MED Catalogue: Medicine, Health, Nutrition, Environment, Agriculture

    Full text online

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  10. Article ; Online: 18s rDNA characterization and morphological investigation of the medicinal leech Hirudo medicinalis from Felaw Pond.

    Jawdat Bilal, Samir

    Cellular and molecular biology (Noisy-le-Grand, France)

    2024  Volume 70, Issue 1, Page(s) 143–147

    Abstract: Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is ... ...

    Abstract Hirudinea leeches are obligate parasites on a variety of vertebrates and have recently gained attention for their medicinal purposes. The present study aimed to improve the presence of Hirudo medicinalis in Kurdistan and Iraq (especially because it is regarded as a native species in this region). A total of 23 leech specimens were collected from Felaw Pond during January-July 2023. The collected specimens were investigated morphologically and their species were confirmed according to their partial sequence of 18s rDNA. Primers used were universal, C1 (ACCCGCTGAATTTAAGCAT) (forward primer), and C3 (CTCTTCAGAGTACTTTTCAAC) (reverse primer). The results of the morphological study and molecular sequencing of partial 18s rDNA demonstrated that all these leech specimens belonged to Hirudo medicinalis with an abundance of 0.13 leech/ m2. The present record was the first one investigating this species in Iraq.
    MeSH term(s) Animals ; Hirudo medicinalis/genetics ; DNA, Ribosomal/genetics ; Ponds ; Leeches/genetics ; DNA Primers
    Chemical Substances DNA, Ribosomal ; DNA Primers
    Language English
    Publishing date 2024-01-31
    Publishing country France
    Document type Journal Article
    ZDB-ID 1161779-2
    ISSN 1165-158X ; 0145-5680
    ISSN (online) 1165-158X
    ISSN 0145-5680
    DOI 10.14715/cmb/2024.70.1.19
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 3812: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (2.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

To top