LIVIVO - Search results -

Search results

Result 1 - 10 of total 36

Search options

Article: Distinct regions within SAP25 recruit O-linked glycosylation, DNA demethylation, and ubiquitin ligase and hydrolase activities to the Sin3/HDAC complex.

Goswami, Pratik / Banks, Charles A S / Thornton, Janet / Bengs, Bethany / Sardiu, Mihaela E / Florens, Laurence / Washburn, Michael P

bioRxiv : the preprint server for biology

2024

Abstract: Epigenetic control of gene expression is crucial for maintaining gene regulation. Sin3 is an evolutionarily conserved repressor protein complex mainly associated with histone deacetylase (HDAC) activity. A large number of proteins are part of Sin3/HDAC ... ...

Abstract	Epigenetic control of gene expression is crucial for maintaining gene regulation. Sin3 is an evolutionarily conserved repressor protein complex mainly associated with histone deacetylase (HDAC) activity. A large number of proteins are part of Sin3/HDAC complexes, and the function of most of these members remains poorly understood. SAP25, a previously identified Sin3A associated protein of 25 kDa, has been proposed to participate in regulating gene expression programs involved in the immune response but the exact mechanism of this regulation is unclear. SAP25 is not expressed in HEK293 cells, which hence serve as a natural knockout system to decipher the molecular functions uniquely carried out by this Sin3/HDAC subunit. Using molecular, proteomic, protein engineering, and interaction network approaches, we show that SAP25 interacts with distinct enzymatic and regulatory protein complexes in addition to Sin3/HDAC. While the O-GlcNAc transferase (OGT) and the TET1 /TET2/TET3 methylcytosine dioxygenases have been previously linked to Sin3/HDAC, in HEK293 cells, these interactions were only observed in the affinity purification in which an exogenously expressed SAP25 was the bait. Additional proteins uniquely recovered from the Halo-SAP25 pull-downs included the SCF E3 ubiquitin ligase complex SKP1/FBXO3/CUL1 and the ubiquitin carboxyl-terminal hydrolase 11 (USP11), which have not been previously associated with Sin3/HDAC. Finally, we use mutational analysis to demonstrate that distinct regions of SAP25 participate in its interaction with USP11, OGT/TETs, and SCF(FBXO3).) These results suggest that SAP25 may function as an adaptor protein to coordinate the assembly of different enzymatic complexes to control Sin3/HDAC-mediated gene expression.
Language	English
Publishing date	2024-03-08
Publishing country	United States
Document type	Preprint
DOI	10.1101/2024.03.05.583553
Database	MEDical Literature Analysis and Retrieval System OnLINE

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾

Article: FakeBERT: Fake news detection in social media with a BERT-based deep learning approach.

Kaliyar, Rohit Kumar / Goswami, Anurag / Narang, Pratik

Multimedia tools and applications

2021 Volume 80, Issue 8, Page(s) 11765–11788

Abstract: In the modern era of computing, the news ecosystem has transformed from old traditional print media to social media outlets. Social media platforms allow us to consume news much faster, with less restricted editing results in the spread of fake news at ... ...

Abstract	In the modern era of computing, the news ecosystem has transformed from old traditional print media to social media outlets. Social media platforms allow us to consume news much faster, with less restricted editing results in the spread of fake news at an incredible pace and scale. In recent researches, many useful methods for fake news detection employ sequential neural networks to encode news content and social context-level information where the text sequence was analyzed in a unidirectional way. Therefore, a bidirectional training approach is a priority for modelling the relevant information of fake news that is capable of improving the classification performance with the ability to capture semantic and long-distance dependencies in sentences. In this paper, we propose a BERT-based (Bidirectional Encoder Representations from Transformers) deep learning approach (FakeBERT) by combining different parallel blocks of the single-layer deep Convolutional Neural Network (CNN) having different kernel sizes and filters with the BERT. Such a combination is useful to handle ambiguity, which is the greatest challenge to natural language understanding. Classification results demonstrate that our proposed model (FakeBERT) outperforms the existing models with an accuracy of 98.90%.
Language	English
Publishing date	2021-01-07
Publishing country	United States
Document type	News
ZDB-ID	1479928-5
ISSN	1573-7721 ; 1380-7501
ISSN (online)	1573-7721
ISSN	1380-7501
DOI	10.1007/s11042-020-10183-2
Database	MEDical Literature Analysis and Retrieval System OnLINE

Full text online

Accessible to users with ZB MED library card

Order via subito

This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

Details ▾
- Full text online
- Order with fees

Article: EchoFakeD: improving fake news detection in social media with an efficient deep neural network.

Kaliyar, Rohit Kumar / Goswami, Anurag / Narang, Pratik

Neural computing & applications

2021 Volume 33, Issue 14, Page(s) 8597–8613

Abstract: The increasing popularity of social media platforms has simplified the sharing of news articles that have led to the explosion in fake news. With the emergence of fake news at a very rapid rate, a serious concern has produced in our society because of ... ...

Abstract	The increasing popularity of social media platforms has simplified the sharing of news articles that have led to the explosion in fake news. With the emergence of fake news at a very rapid rate, a serious concern has produced in our society because of enormous fake content dissemination. The quality of the news content is questionable and there exists a necessity for an automated tool for the detection. Existing studies primarily focus on utilizing information extracted from the news content. We suggest that user-based engagements and the context related group of people (echo-chamber) sharing the same opinions can play a vital role in the fake news detection. Hence, in this paper, we have focused on both the content of the news article and the existence of echo chambers in the social network for fake news detection. Standard factorization methods for fake news detection have limited effectiveness due to their unsupervised nature and primarily employed with traditional machine learning models. To design an effective deep learning model with tensor factorization approach is the priority. In our approach, the news content is fused with the tensor following a coupled matrix-tensor factorization method to get a latent representation of both news content as well as social context. We have designed our model with a different number of filters across each dense layer along with dropout. To classify on news content and social context-based information individually as well as in combination, a deep neural network (our proposed model) was employed with optimal hyper-parameters. The performance of our proposed approach has been validated on a real-world fake news dataset: BuzzFeed and PolitiFact. Classification results have demonstrated that our proposed model (EchoFakeD) outperforms existing and appropriate baselines for fake news detection and achieved a validation accuracy of 92.30%. These results have shown significant improvements over the existing state-of-the-art models in the area of fake news detection and affirm the potential use of the technique for classifying fake news.
Language	English
Publishing date	2021-01-02
Publishing country	England
Document type	News
ZDB-ID	1480526-1
ISSN	1433-3058 ; 0941-0643
ISSN (online)	1433-3058
ISSN	0941-0643
DOI	10.1007/s00521-020-05611-1
Database	MEDical Literature Analysis and Retrieval System OnLINE

Full text online

Accessible to users with ZB MED library card

Order via subito

Details ▾
- Full text online
- Order with fees

Article ; Online: Superradiance and Directional Exciton Migration in Metal-Organic Frameworks.

Rajasree, Sreehari Surendran / Yu, Jierui / Pratik, Saied Md / Li, Xinlin / Wang, Rui / Kumbhar, Amar S / Goswami, Subhadip / Cramer, Christopher J / Deria, Pravas

Journal of the American Chemical Society

2022 Volume 144, Issue 3, Page(s) 1396–1406

Abstract: Crystalline metal-organic frameworks (MOFs) are promising synthetic analogues of photosynthetic light-harvesting complexes (LHCs). The precise assembly of linkers (organic chromophores) around the topology-defined pores offers the evolution of unique ... ...

Abstract	Crystalline metal-organic frameworks (MOFs) are promising synthetic analogues of photosynthetic light-harvesting complexes (LHCs). The precise assembly of linkers (organic chromophores) around the topology-defined pores offers the evolution of unique photophysical behaviors that are reminiscence of LHCs. These include MOF excited states with photoabsorbed energy that is spatially dispersed over multiple linkers defining the molecular excitons. The multilinker molecular excitons display superradiance─a hallmark of coupled oscillators seen in LHCs─with radiative rate constant (
Language	English
Publishing date	2022-01-14
Publishing country	United States
Document type	Journal Article ; Research Support, U.S. Gov't, Non-P.H.S.
ZDB-ID	3155-0
ISSN	1520-5126 ; 0002-7863
ISSN (online)	1520-5126
ISSN	0002-7863
DOI	10.1021/jacs.1c11979
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Bonn / Germany

Z 4' 55/32: Show issues
Z 7.3: Show issues

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Metal-Carbodithioate-Based 3D Semiconducting Metal-Organic Framework: Porous Optoelectronic Material for Energy Conversion.

Li, Xinlin / Anderson, Ryther / Fry, H Christopher / Pratik, Saied Md / Xu, Wenqian / Goswami, Subhadip / Allen, Taylor G / Yu, Jierui / Rajasree, Sreehari Surendran / Cramer, Christopher J / Rumbles, Garry / Gómez-Gualdrón, Diego A / Deria, Pravas

ACS applied materials & interfaces

2023 Volume 15, Issue 23, Page(s) 28228–28239

Abstract: Solar energy conversion requires the working compositions to generate photoinduced charges with high potential and the ability to deliver charges to the catalytic sites and/or external electrode. These two properties are typically at odds with each other ...

Abstract	Solar energy conversion requires the working compositions to generate photoinduced charges with high potential and the ability to deliver charges to the catalytic sites and/or external electrode. These two properties are typically at odds with each other and call for new molecular materials with sufficient conjugation to improve charge conductivity but not as much conjugation as to overly compromise the optical band gap. In this work, we developed a semiconducting metal-organic framework (MOF) prepared explicitly through metal-carbodithioate "(-CS
Language	English
Publishing date	2023-05-31
Publishing country	United States
Document type	Journal Article
ISSN	1944-8252
ISSN (online)	1944-8252
DOI	10.1021/acsami.3c04200
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Article: Efficacy of Oral Colchicine and Intralesional Hyaluronidase with and without Ultrasound Therapy in the Management of Oral Submucous Fibrosis-A Comparative Study.

Shil, Malabika / Goswami, Poulami / Gaikwad, Trupti Vijay / Jadaun, Gargi / Sridhar, T / Bandyopadhyay, Basudhara / Surana, Pratik

Journal of pharmacy & bioallied sciences

2023 Volume 16, Issue Suppl 1, Page(s) S586–S588

Abstract: Aim: To determine the therapeutic effect and efficacy of oral colchicine tablet and intralesional injection of hyaluronidase with and without ultrasound therapy in the clinical course of oral submucous fibrosis.: Materials and methods: This ... ...

Abstract	Aim: To determine the therapeutic effect and efficacy of oral colchicine tablet and intralesional injection of hyaluronidase with and without ultrasound therapy in the clinical course of oral submucous fibrosis. Materials and methods: This comparative study involving 45 human participants was divided into three equal groups. The participants in group 1 received oral colchicine and intralesional hyaluronidase. The participants in group 2 received oral colchicine, intralesional hyaluronidase, and ultrasound therapy. The group 3 participants were treated with intralesional dexamethasone and hyaluronidase. Intergroup assessments were done using repeated measures of ANOVA test, where Results: Group 2 patients had maximum improvement with respect to all the parameters. Conclusion: Therapeutic ultrasound can be given effectively as an adjunct therapy along with conventional therapy in OSMF patients.
Language	English
Publishing date	2023-11-07
Publishing country	India
Document type	Journal Article
ZDB-ID	2573569-X
ISSN	0975-7406 ; 0976-4879
ISSN (online)	0975-7406
ISSN	0976-4879
DOI	10.4103/jpbs.jpbs_879_23
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Article ; Online: Interaction of C-terminal p53 isoforms depends strongly upon DNA sequence and topology.

Goswami, Pratik / Šislerová, Lucie / Dobrovolná, Michaela / Havlík, Jan / Šťastný, Jiří / Brázda, Václav

Biochimie

2022 Volume 208, Page(s) 93–99

Abstract: The p53 protein is a key tumor suppressor and the most commonly mutated and down-regulated protein in human tumors. It functions mainly through interaction with DNA, and p53 acts as a transcription factor that recognizes the so-called p53 target sites on ...

Abstract	The p53 protein is a key tumor suppressor and the most commonly mutated and down-regulated protein in human tumors. It functions mainly through interaction with DNA, and p53 acts as a transcription factor that recognizes the so-called p53 target sites on the promoters of various genes. P53 has been shown to exist as many isoforms, including three C-terminal isoforms that are produced by alternative splicing. Because the C-terminal domain is responsible for sequence-nonspecific binding and regulation of p53 binding, we have analyzed DNA recognition by these C-terminal isoforms. Using atomic force microscopy, we show for the first time that all C-terminal isoforms recognize superhelical DNA. It is particularly noteworthy that a sequence-specific p53 consensus binding site is bound by p53α and β isoforms with similar affinities, whilst p53α shows higher binding to a quadruplex sequence than both p53β and p53γ, and p53γ loses preferential binding to both the consensus binding sequence and the quadruplex-forming sequence. These results show the important role of the variable p53 C-terminal amino acid sequences for DNA recognition.
MeSH term(s)	Humans ; Tumor Suppressor Protein p53/metabolism ; Base Sequence ; Protein Isoforms/genetics ; Protein Isoforms/metabolism ; Alternative Splicing ; DNA/genetics ; DNA/metabolism
Chemical Substances	Tumor Suppressor Protein p53 ; Protein Isoforms ; DNA (9007-49-2)
Language	English
Publishing date	2022-12-20
Publishing country	France
Document type	Journal Article
ZDB-ID	120345-9
ISSN	1638-6183 ; 0300-9084
ISSN (online)	1638-6183
ISSN	0300-9084
DOI	10.1016/j.biochi.2022.12.011
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Uc I Zs.135: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene.

Legartová, Soňa / Fagherazzi, Paolo / Goswami, Pratik / Brazda, Vaclav / Lochmanová, Gabriela / Koutná, Irena / Bártová, Eva

Biochimie

2022

Abstract: An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction ... ...

Abstract	An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.
Language	English
Publishing date	2022-09-24
Publishing country	France
Document type	Journal Article
ZDB-ID	120345-9
ISSN	1638-6183 ; 0300-9084
ISSN (online)	1638-6183
ISSN	0300-9084
DOI	10.1016/j.biochi.2022.09.013
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Uc I Zs.135: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article: AENeT: an attention-enabled neural architecture for fake news detection using contextual features.

Jain, Vidit / Kaliyar, Rohit Kumar / Goswami, Anurag / Narang, Pratik / Sharma, Yashvardhan

Neural computing & applications

2021 Volume 34, Issue 1, Page(s) 771–782

Abstract: In the current era of social media, the popularity of smartphones and social media platforms has increased exponentially. Through these electronic media, fake news has been rising rapidly with the advent of new sources of information, which are highly ... ...

Abstract	In the current era of social media, the popularity of smartphones and social media platforms has increased exponentially. Through these electronic media, fake news has been rising rapidly with the advent of new sources of information, which are highly unreliable. Checking off a particular news article is genuine or fake is not easy for any end user. Search engines like Google are also not capable of telling about the fakeness of any news article due to its restriction with limited query keywords. In this paper, our end goal is to design an efficient deep learning model to detect the degree of fakeness in a news statement. We propose a simple network architecture that combines the use of contextual embedding as word embedding and uses attention mechanisms with relevant metadata available. The efficacy and efficiency of our models are demonstrated on several real-world datasets. Our model achieved 46.36% accuracy on the LIAR dataset, which outperforms the current state of the art by 1.49%.
Language	English
Publishing date	2021-08-29
Publishing country	England
Document type	News
ZDB-ID	1480526-1
ISSN	1433-3058 ; 0941-0643
ISSN (online)	1433-3058
ISSN	0941-0643
DOI	10.1007/s00521-021-06450-4
Database	MEDical Literature Analysis and Retrieval System OnLINE

Full text online

Accessible to users with ZB MED library card

Order via subito

Details ▾
- Full text online
- Order with fees

Article: Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene

Legartová, Soňa / Fagherazzi, Paolo / Goswami, Pratik / Brazda, Vaclav / Lochmanová, Gabriela / Koutná, Irena / Bártová, Eva

Biochimie. 2022 Sept. 21,

2022

Abstract	An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.
Keywords	DNA ; DNA damage ; DNA-binding domains ; acetylation ; arginine ; atomic force microscopy ; chromatin ; confocal microscopy ; energy transfer ; fluorescence ; gene expression ; genes ; irradiation ; mass spectrometry ; methylation ; neoplasms ; phosphorylation
Language	English
Dates of publication	2022-0921
Publishing place	Elsevier B.V.
Document type	Article
Note	Pre-press version
ZDB-ID	120345-9
ISSN	0300-9084
ISSN	0300-9084
DOI	10.1016/j.biochi.2022.09.013
Database	NAL-Catalogue (AGRICOLA)

In stock of ZB MED Bonn / Germany

Z 72/375: Show issues

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

To top

More links

Kategorien

Inter-library loan at ZB MED

Full text online

More links

Kategorien

Order via subito

Full text online

More links

Kategorien

Order via subito

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

Full text online

More links

Kategorien

Order via subito

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED