LIVIVO - The Search Portal for Life Sciences

zur deutschen Oberfläche wechseln
Advanced search

Search results

Result 1 - 10 of total 120

Search options

  1. Article ; Online: Outbreaks of Neoechinorhynchus buttnerae (Acanthocephala) infection in raised semi-intensively Colossoma macropomum in Theobroma, Rondônia state, Western Amazon

    Carina Fernanda Pereira de Jesus Lucena / Jerônimo Vieira Dantas Filho / Aristoteles Marcos Silva Ferreira / Ana Sabrina Coutinho Marques Rocha / Sandro de Vargas Schons / Paulo Henrique Gilio Gasparotto

    Acta Veterinaria Brasilica, Vol 17, Iss 1, Pp 62-

    2023  Volume 69

    Abstract: The aim of this study was to describe two outbreaks of Neoechinorhynchus buttnerae parasitizing Colossoma macropomum raised semi-intensively in the Theobroma municipality, Rondônia state, Brazil. It was reported by owner that the animals had a history of ...

    Abstract The aim of this study was to describe two outbreaks of Neoechinorhynchus buttnerae parasitizing Colossoma macropomum raised semi-intensively in the Theobroma municipality, Rondônia state, Brazil. It was reported by owner that the animals had a history of poor weight gain and decreased food intake. C. macropomum that weighed around 1.5 kg were clinically evaluated where the body surface, fins, buccal and brachial cavity were carefully analyzed and no changes were found. N. buttnerae was the only intestinal parasite found in the specimens studied, and its distribution pattern showes a preference for the posterior portion of the intestine of C. macropomum. All 50 fish examined were parasitized by at least one N. buttnerae. This parasite was found in the digestive system of the examined fish. 100% of prevalence, 430 of intensity, 8.6 of average intensity and average abundance were found. Although there was no record of mortalities due to acanthocephalosis, damage that compromised the feed conversion of the fish was recorded. C. macropomum were infected by ingesting a crustacean containing cystacanth, the infective larval form of the parasite. Damage, such as presence of nodules, hypertrophy of goblet cells, thickening of the muscle layer, metaplasia in muscle tissue, severe edema from leukocyte infiltration in blood vessels and necrotic foci, were found in the intestine due to high infection rates of N. buttnerae. That said, inspection activities are essential for the preservation of consumer and animal health.
    Keywords fish farming ; fish healthiness ; intestinal parasite ; preventive measures ; Veterinary medicine ; SF600-1100
    Language English
    Publishing date 2023-06-01T00:00:00Z
    Publisher Universidade Federal Rural do Semi-Árido (UFERSA)
    Document type Article ; Online
    Database BASE - Bielefeld Academic Search Engine (life sciences selection)

    Full text online

    More links

    Kategorien

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  2. Article ; Online: Effect of low-level light therapy before radiotherapy in oral squamous cell carcinoma: An in vitro study.

    Tabosa, Angeliny Tamiarana Lima / Souza, Marcela Gonçalves / de Jesus, Sabrina Ferreira / Rocha, Danielle Ferreira / Queiroz, Lorena Dos Reis Pereira / Santos, Eloá Mangabeira / Guimarães, Victor Hugo Dantas / Andrade, Luciano Alves de Araújo / Santos, Sérgio Henrique / de Paula, Alfredo Maurício Batista / de Souza, Paulo Eduardo Narcizo / Farias, Lucyana Conceição / Guimarães, André Luiz Sena

    Lasers in medical science

    2022  Volume 37, Issue 9, Page(s) 3527–3536

    Abstract: Radiation therapy for head and neck squamous cell carcinoma (HNSCC) is associated with several complications. Although photobiomodulation (PBM) has radioprotective effects in normal tissue, it could also enhance the growth of neoplastic cells. Thus, the ... ...

    Abstract Radiation therapy for head and neck squamous cell carcinoma (HNSCC) is associated with several complications. Although photobiomodulation (PBM) has radioprotective effects in normal tissue, it could also enhance the growth of neoplastic cells. Thus, the present study aimed to investigate the cellular response of oral squamous cell carcinoma with pre-exposure to low-level phototherapy before radiotherapy. SCC9, Cal-27, A431, and HaCaT cell lines were subjected to low-level light therapy and radiotherapy. The cells were treated with a single energy density (300 J/cm
    MeSH term(s) Humans ; Squamous Cell Carcinoma of Head and Neck/radiotherapy ; Squamous Cell Carcinoma of Head and Neck/etiology ; Mouth Neoplasms/radiotherapy ; Mouth Neoplasms/pathology ; Carcinoma, Squamous Cell/radiotherapy ; Carcinoma, Squamous Cell/pathology ; Low-Level Light Therapy/methods ; Reactive Oxygen Species ; Head and Neck Neoplasms/radiotherapy
    Chemical Substances Reactive Oxygen Species
    Language English
    Publishing date 2022-08-24
    Publishing country England
    Document type Journal Article
    ZDB-ID 632808-8
    ISSN 1435-604X ; 0268-8921
    ISSN (online) 1435-604X
    ISSN 0268-8921
    DOI 10.1007/s10103-022-03632-x
    Database MEDical Literature Analysis and Retrieval System OnLINE

    Full text online

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 2148: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (1.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  3. Article ; Online: Gallic acid has an inhibitory effect on skin squamous cell carcinoma and acts on the heat shock protein HSP90AB1.

    de Jesus, Sabrina Ferreira / de Souza, Marcela Gonçalves / Queiroz, Lorena Dos Reis Pereira / de Paula, Daniela Paola Santos / Tabosa, Angeliny Tamiarana Lima / Alves, Wislene Sarajane Moreira / da Silveira, Luiz Henrique / Ferreira, André Teixeira da Silva / Martuscelli, Ozires José Dutra / Farias, Lucyana Conceição / de-Paula, Alfredo Maurício Batista / Santos, Sérgio Henrique Sousa / Guimaraes, André Luiz Sena

    Gene

    2022  Volume 851, Page(s) 147041

    Abstract: Differences in the features of aggressiveness of non-melanoma skin cancer (NMSC) subtypes, between basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) are relevant characteristics. Comparing the characteristics between NMSC subtypes might help ... ...

    Abstract Differences in the features of aggressiveness of non-melanoma skin cancer (NMSC) subtypes, between basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) are relevant characteristics. Comparing the characteristics between NMSC subtypes might help identify molecules associated with cancer metastasis and invasion. Considering these facts, the current study aimed to identify a molecular target for inhibiting skin cancer metastasis and invasion. Proteomic analysis suggested that heat shock protein 90 kDa, alpha, class B member 1 (HSP90AB1), pentaxin (PTX3), caspase-14 (CASP14), S100, actin-1, and profilin were the primary targets related to metastasis and invasion. However, after a differential expression comparison between BCC and SCC, HSP90AB1 was identified as the best target to repress metastasis and invasion. Based on molecular docking results, gallic acid (GA) was selected to inhibit HSP90AB1. A specific Hsp90ab1 siRNA targeting was designed and compared to GA. Interestingly, GA was more efficient in silencing HSP90AB1 than siRNAhsp90ab1. Hence, our data suggest that HSP90AB1 is a crucial biomarker for identifying invasion and metastasis and that its inhibition may be a viable strategy for treating skin cancer.
    MeSH term(s) Humans ; Heat-Shock Proteins ; Gallic Acid/pharmacology ; Proteomics ; Molecular Docking Simulation ; Carcinoma, Basal Cell/metabolism ; Carcinoma, Squamous Cell/pathology ; Skin Neoplasms/drug therapy ; Skin Neoplasms/genetics ; Skin Neoplasms/metabolism ; HSP90 Heat-Shock Proteins/genetics
    Chemical Substances Heat-Shock Proteins ; Gallic Acid (632XD903SP) ; HSP90AB1 protein, human ; HSP90 Heat-Shock Proteins
    Language English
    Publishing date 2022-11-12
    Publishing country Netherlands
    Document type Journal Article
    ZDB-ID 391792-7
    ISSN 1879-0038 ; 0378-1119
    ISSN (online) 1879-0038
    ISSN 0378-1119
    DOI 10.1016/j.gene.2022.147041
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 1357: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (1.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  4. Article ; Online: Acute micro-outbreak of Chagas disease in the southeastern Amazon: a report of five cases.

    Brito, Andreza Karoline Souza Barros de / Sousa, Débora Raysa Teixeira de / Silva Junior, Edson Fidelis da / Ruiz, Helton Jardys da Silva / Arcanjo, Ana Ruth Lima / Ortiz, Jessica Vanina / Brito, Sabrina Silva de / Jesus, Denison Vital / Lima, Jorge Rubens Coelho de / Couceiro, Kátia do Nascimento / Silva, Mônica Regina Hosannah da Silva E / Ferreira, João Marcos Bemfica Barbosa / Guerra, Jorge Augusto Oliveira / Guerra, Maria das Graças Vale Barbosa

    Revista da Sociedade Brasileira de Medicina Tropical

    2022  Volume 55, Page(s) e0687

    Abstract: Background: Chagas disease is gaining importance in the Brazilian Amazon region as a differential diagnosis of febrile syndrome. The most recent microoutbreak occurred in Ipixuna, in Amazonas state.: Methods: An epidemiological survey was conducted ... ...

    Abstract Background: Chagas disease is gaining importance in the Brazilian Amazon region as a differential diagnosis of febrile syndrome. The most recent microoutbreak occurred in Ipixuna, in Amazonas state.
    Methods: An epidemiological survey was conducted using parasitological and serological tests, and electrocardiographic analysis.
    Results: The patients belonged to one family and had ingested açaí acquired from Ipixuna. All patients reported fever and initially a thick blood smear test was done to identify Trypanosoma cruzi. Benznidazole treatment was administered to all patients.
    Conclusions: Knowledge of the epidemiological dynamics of Chagas disease allows us to improve control and management measures for this disease.
    MeSH term(s) Brazil/epidemiology ; Chagas Disease/diagnosis ; Chagas Disease/drug therapy ; Chagas Disease/epidemiology ; Disease Outbreaks ; Humans ; Trypanosoma cruzi
    Language English
    Publishing date 2022-08-22
    Publishing country Brazil
    Document type Case Reports ; Journal Article
    ZDB-ID 1038126-0
    ISSN 1678-9849 ; 0037-8682
    ISSN (online) 1678-9849
    ISSN 0037-8682
    DOI 10.1590/0037-8682-0687-2021
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 2726: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (2.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  5. Article ; Online: Identification of potential biomarkers and survival analysis for oral squamous cell carcinoma: A transcriptomic study.

    de Paula Souza, Daniela Paola Santos / Dos Reis Pereira Queiroz, Lorena / de Souza, Marcela Gonçalves / de Jesus, Sabrina Ferreira / Gomes, Emisael Stênio Batista / Vitorino, Rogério Trancoso / Santos, Sérgio Henrique Sousa / Farias, Lucyana Conceição / de Paula, Alfredo Maurício Batista / D'Angelo, Marcos Flávio Silveira Vasconcelos / de Carvalho Fraga, Carlos Alberto / Guimarães, André Luiz Sena

    Oral diseases

    2022  Volume 29, Issue 7, Page(s) 2658–2666

    Abstract: Objective: Oral squamous cell carcinoma (OSCC) is one of the most common neoplasms worldwide. The current study aimed to identify potential biomarkers associated with OSCC survival.: Materials and methods: Differentially expressed genes (DEGs) in ... ...

    Abstract Objective: Oral squamous cell carcinoma (OSCC) is one of the most common neoplasms worldwide. The current study aimed to identify potential biomarkers associated with OSCC survival.
    Materials and methods: Differentially expressed genes (DEGs) in atypical OSCC cases were identified using two public datasets: The Cancer Genome Atlas and the Gene Expression Omnibus database. Receiver operating characteristic (ROC) analysis was performed to identify the cutoff, and the candidate DEGs related to survival. Kaplan-Meier and Cox regression analysis using the categorized genes were employed to identify genes that impact the overall survival in OSCC.
    Results: A total of 263 OSCC samples and 105 healthy tissues were used to identify 295 upregulated and 131 downregulated genes expressed only in non-smokers. ROC analyses identified 25 candidate genes associated with death. Survival analyses demonstrated that the following DEGs, namely CSTA, FGFR2, MMP19, OLR1, PCSK1, RAMP2, and CGB5, are potential OSCC prognostic factors.
    Conclusion: We found that CSTA, FGFR2, MMP19, OLR1, PCSK1, RAMP2, and CGB5 are associated with a low survival rate in OSCC. However, further studies are needed to validate our findings and facilitate the development of these factors as potential biomarkers for OSCC survival.
    MeSH term(s) Humans ; Squamous Cell Carcinoma of Head and Neck/genetics ; Carcinoma, Squamous Cell/pathology ; Transcriptome ; Mouth Neoplasms/metabolism ; Gene Expression Regulation, Neoplastic ; Survival Analysis ; Biomarkers, Tumor/genetics ; Head and Neck Neoplasms/genetics ; Prognosis
    Chemical Substances Biomarkers, Tumor
    Language English
    Publishing date 2022-07-22
    Publishing country Denmark
    Document type Journal Article
    ZDB-ID 1290529-x
    ISSN 1601-0825 ; 1354-523X
    ISSN (online) 1601-0825
    ISSN 1354-523X
    DOI 10.1111/odi.14302
    Database MEDical Literature Analysis and Retrieval System OnLINE

    Full text online

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 4427: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (2.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  6. Article ; Online: Therapeutic perceptions in antisense RNA-mediated gene regulation for COVID-19.

    de Jesus, Sabrina Ferreira / Santos, Laércio Ives / Rodrigues Neto, João Felício / Vieira, Thallyta Maria / Mendes, João Batista / D'angelo, Marcos Flavio Silveira Vasconcelos / Guimaraes, André Luiz Sena

    Gene

    2021  Volume 800, Page(s) 145839

    Abstract: COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully ... ...

    Abstract COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® ≫ blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.
    MeSH term(s) Algorithms ; COVID-19/genetics ; COVID-19/virology ; Computer Simulation ; Gene Expression Regulation, Viral ; Humans ; RNA, Antisense/genetics ; SARS-CoV-2/genetics
    Chemical Substances RNA, Antisense
    Language English
    Publishing date 2021-07-16
    Publishing country Netherlands
    Document type Journal Article
    ZDB-ID 391792-7
    ISSN 1879-0038 ; 0378-1119
    ISSN (online) 1879-0038
    ISSN 0378-1119
    DOI 10.1016/j.gene.2021.145839
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 1357: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (1.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  7. Article ; Online: Prion protein is associated with a worse prognosis of head and neck squamous cell carcinoma.

    Santos, Eloa Mangabeira / Fraga, Carlos Alberto de Carvalho / Xavier, Alessandra Rejane Ericsson de Oliveira / Xavier, Mauro Aparecido de Souza / Souza, Marcela Gonçalves / Jesus, Sabrina Ferreira de / Paula, Alfredo Maurício Batista de / Farias, Lucyana Conceição / Santos, Sérgio Henrique Sousa / Santos, Tiago Goss / Beraldo, Flavio H / Guimarães, André Luiz Sena

    Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology

    2021  Volume 50, Issue 10, Page(s) 985–994

    Abstract: Background: Head and neck squamous cell carcinoma (HNSC) etiopathogenesis remains unclear, and the biological changes with the activation of heat shock proteins (HSPs) and prion protein (PRNP) promoted by hypoxia in HNSC are undetermined. This study ... ...

    Abstract Background: Head and neck squamous cell carcinoma (HNSC) etiopathogenesis remains unclear, and the biological changes with the activation of heat shock proteins (HSPs) and prion protein (PRNP) promoted by hypoxia in HNSC are undetermined. This study investigates hypoxia's effect in lymph node metastasis by PRNP expression changes and its main partners.
    Methods: The study combined a theoretical/cell culture study with a case-control study. First, bioinformatics and cell culture were performed. A case-control study was performed in a second step by comparing HNSC patients with and without lymph node metastasis.
    Analyses: The Cancer Genome Atlas (TCGA) data source validates the theory in the global population study.
    Results: Bioinformatics analysis suggests that hypoxia-inducible factor-1α (HIF1A) is associated with HSPA4, HSP90AA1 and PRNP expression. TCGA data validate the hypothesis that higher HSP90AA1, HSPA4 and PRNP are related to metastases and low survival. Herein, the cell study demonstrated that muted PRNP did not respond to hypoxia.
    Discussion: Our results collectively provide the first evidence that PRNP promotes HNSC lymph node metastasis progression through the upregulation of HSPA4, HSP90AA1 and HIF1A. Our findings may provide a molecular basis for the promoting Role of PRNP in HNSC progression.
    MeSH term(s) Biomarkers, Tumor/genetics ; Case-Control Studies ; Head and Neck Neoplasms/genetics ; Humans ; Prion Proteins/genetics ; Prognosis ; Squamous Cell Carcinoma of Head and Neck/genetics
    Chemical Substances Biomarkers, Tumor ; Prion Proteins
    Language English
    Publishing date 2021-05-24
    Publishing country Denmark
    Document type Journal Article
    ZDB-ID 1021270-x
    ISSN 1600-0714 ; 0904-2512
    ISSN (online) 1600-0714
    ISSN 0904-2512
    DOI 10.1111/jop.13188
    Database MEDical Literature Analysis and Retrieval System OnLINE

    Full text online

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 825: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (1.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  8. Article: Therapeutic perceptions in antisense RNA-mediated gene regulation for COVID-19

    de Jesus, Sabrina Ferreira / Santos, Laércio Ives / Rodrigues Neto, João Felício / Vieira, Thallyta Maria / Mendes, João Batista / D'angelo, Marcos Flavio Silveira Vasconcelos / Guimaraes, André Luiz Sena

    Gene. 2021 Oct. 20, v. 800

    2021  

    Abstract: COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully ... ...

    Abstract COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® ≫ blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.
    Keywords COVID-19 infection ; National Center for Biotechnology Information ; Severe acute respiratory syndrome coronavirus ; Severe acute respiratory syndrome coronavirus 2 ; algorithms ; antisense RNA ; data collection ; genes ; nucleotides ; vaccination ; China
    Language English
    Dates of publication 2021-1020
    Publishing place Elsevier B.V.
    Document type Article
    ZDB-ID 391792-7
    ISSN 1879-0038 ; 0378-1119
    ISSN (online) 1879-0038
    ISSN 0378-1119
    DOI 10.1016/j.gene.2021.145839
    Database NAL-Catalogue (AGRICOLA)

    More links

    Kategorien

    In stock of ZB MED Bonn / Germany

    Z 79/715: Show issues

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  9. Article ; Online: Might anxiety disorders promote head and neck cancer development?

    de Souza, Marcela Gonçalves / Gomes, Emisael Stênio Batista / Costa, Lorena Barbosa / Andrade, Amanda Dias Silva / de Jesus, Sabrina Ferreira / de Paula, Daniela Paola Santos / Rocha, Rogério Gonçalves da / Santos, Sérgio Henrique Sousa / de Paula, Alfredo Maurício Batista / Farias, Lucyana Conceição / Guimaraes, André Luiz Sena

    IBRO reports

    2020  Volume 9, Page(s) 9–13

    Abstract: Cancer patients present a higher risk of experiencing anxiety disorders (AD). However, it is not clear if AD might be associated with cancer development. Thus, our study aimed to evaluate if AD might be related to head and neck squamous cell carcinoma ( ... ...

    Abstract Cancer patients present a higher risk of experiencing anxiety disorders (AD). However, it is not clear if AD might be associated with cancer development. Thus, our study aimed to evaluate if AD might be related to head and neck squamous cell carcinoma (HNSCC) development. The combination of an applied animal basic study and a retrospective diagnostic case and control study in patients was performed. As a result, we obtained that stress reduced the locomotor activity of the animals in the group stress and stress + 4NqO (p < 0.0001). The stress showed no influence on the progression of neoplasia in mice. In the same way, the case group did not present differences in anxiety scores in comparison to control. Moreover, no association between HNSCC staging and anxiety scores was observed. In conclusion, our in vivo findings in humans and animals have shown that there is no relationship between AD and oral squamous cell carcinoma.
    Language English
    Publishing date 2020-06-20
    Publishing country England
    Document type Journal Article
    ISSN 2451-8301
    ISSN (online) 2451-8301
    DOI 10.1016/j.ibror.2020.06.001
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  10. Article ; Online: Is HIF1-a deregulated in malignant salivary neoplasms?

    Cardoso, Claudio Marcelo / de Jesus, Sabrina Ferreira / de Souza, Marcela Gonçalves / Santos, Eloa Mangabeira / Santos, Cristiane Karine Cordeiro / Silveira, Christine Mendes / Santos, Sérgio Henrique Sousa / de Paula, Alfredo Maurício Batista / Farias, Lucyana Conceição / Guimarães, André Luiz Sena

    Gene

    2019  Volume 701, Page(s) 41–45

    Abstract: Background: There is significant controversy in the literature regarding the relationship between hypoxia and salivary gland neoplasms (SGNs).: Objective: The current study aims to investigate levels of hypoxia markers in both benign and malignant ... ...

    Abstract Background: There is significant controversy in the literature regarding the relationship between hypoxia and salivary gland neoplasms (SGNs).
    Objective: The current study aims to investigate levels of hypoxia markers in both benign and malignant salivary neoplasms.
    Patients and methods: The current study sample is comprised of a total of 62 samples. HIF-1α expression was evaluated by immunohistochemistry. Additionally, HIF-1α mRNA and miR-210 levels were assessed using qRT-PCR.
    Results: No differences in HIF-1α expression were observed among the control group, benign and malignant SGNs. Similarly, HIF-1α mRNA levels were similar between benign and malignant SGNs. Also, there was no difference in miR-210 expression between case and control groups.
    Conclusion: The angiogenic markers, miR-210 and HIF-1α, do not appear to distinguish malignancy in salivary glands.
    MeSH term(s) Biomarkers, Tumor/biosynthesis ; Cross-Sectional Studies ; Female ; Gene Expression Regulation, Neoplastic ; Humans ; Hypoxia-Inducible Factor 1, alpha Subunit/biosynthesis ; Male ; MicroRNAs/biosynthesis ; Neoplasm Proteins/biosynthesis ; Neovascularization, Pathologic/metabolism ; Neovascularization, Pathologic/pathology ; RNA, Neoplasm/biosynthesis ; Retrospective Studies ; Salivary Gland Neoplasms/blood supply ; Salivary Gland Neoplasms/metabolism ; Salivary Gland Neoplasms/pathology
    Chemical Substances Biomarkers, Tumor ; HIF1A protein, human ; Hypoxia-Inducible Factor 1, alpha Subunit ; MIRN210 microRNA, human ; MicroRNAs ; Neoplasm Proteins ; RNA, Neoplasm
    Language English
    Publishing date 2019-03-19
    Publishing country Netherlands
    Document type Clinical Trial ; Journal Article
    ZDB-ID 391792-7
    ISSN 1879-0038 ; 0378-1119
    ISSN (online) 1879-0038
    ISSN 0378-1119
    DOI 10.1016/j.gene.2019.03.017
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 1357: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (1.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

To top