LIVIVO - The Search Portal for Life Sciences

zur deutschen Oberfläche wechseln
Advanced search

Search results

Result 1 - 7 of total 7

Search options

  1. Article ; Online: The Role of Non-Coding RNAs in the Human Placenta.

    Žarković, Milena / Hufsky, Franziska / Markert, Udo R / Marz, Manja

    Cells

    2022  Volume 11, Issue 9

    Abstract: Non-coding RNAs (ncRNAs) play a central and regulatory role in almost all cells, organs, and species, which has been broadly recognized since the human ENCODE project and several other genome projects. Nevertheless, a small fraction of ncRNAs have been ... ...

    Abstract Non-coding RNAs (ncRNAs) play a central and regulatory role in almost all cells, organs, and species, which has been broadly recognized since the human ENCODE project and several other genome projects. Nevertheless, a small fraction of ncRNAs have been identified, and in the placenta they have been investigated very marginally. To date, most examples of ncRNAs which have been identified to be specific for fetal tissues, including placenta, are members of the group of microRNAs (miRNAs). Due to their quantity, it can be expected that the fairly larger group of other ncRNAs exerts far stronger effects than miRNAs. The syncytiotrophoblast of fetal origin forms the interface between fetus and mother, and releases permanently extracellular vesicles (EVs) into the maternal circulation which contain fetal proteins and RNA, including ncRNA, for communication with neighboring and distant maternal cells. Disorders of ncRNA in placental tissue, especially in trophoblast cells, and in EVs seem to be involved in pregnancy disorders, potentially as a cause or consequence. This review summarizes the current knowledge on placental ncRNA, their transport in EVs, and their involvement and pregnancy pathologies, as well as their potential for novel diagnostic tools.
    MeSH term(s) Extracellular Vesicles/metabolism ; Female ; Humans ; MicroRNAs/genetics ; MicroRNAs/metabolism ; Placenta/metabolism ; Pregnancy ; RNA, Untranslated/genetics ; RNA, Untranslated/metabolism ; Trophoblasts/metabolism
    Chemical Substances MicroRNAs ; RNA, Untranslated
    Language English
    Publishing date 2022-05-09
    Publishing country Switzerland
    Document type Journal Article ; Review ; Research Support, Non-U.S. Gov't
    ZDB-ID 2661518-6
    ISSN 2073-4409 ; 2073-4409
    ISSN (online) 2073-4409
    ISSN 2073-4409
    DOI 10.3390/cells11091588
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  2. Article ; Online: Assembling highly repetitive Xanthomonas TALomes using Oxford Nanopore sequencing.

    Erkes, Annett / Grove, René P / Žarković, Milena / Krautwurst, Sebastian / Koebnik, Ralf / Morgan, Richard D / Wilson, Geoffrey G / Hölzer, Martin / Marz, Manja / Boch, Jens / Grau, Jan

    BMC genomics

    2023  Volume 24, Issue 1, Page(s) 151

    Abstract: Background: Most plant-pathogenic Xanthomonas bacteria harbor transcription activator-like effector (TALE) genes, which function as transcriptional activators of host plant genes and support infection. The entire repertoire of up to 29 TALE genes of a ... ...

    Abstract Background: Most plant-pathogenic Xanthomonas bacteria harbor transcription activator-like effector (TALE) genes, which function as transcriptional activators of host plant genes and support infection. The entire repertoire of up to 29 TALE genes of a Xanthomonas strain is also referred to as TALome. The DNA-binding domain of TALEs is comprised of highly conserved repeats and TALE genes often occur in gene clusters, which precludes the assembly of TALE-carrying Xanthomonas genomes based on standard sequencing approaches.
    Results: Here, we report the successful assembly of the 5 Mbp genomes of five Xanthomonas strains from Oxford Nanopore Technologies (ONT) sequencing data. For one of these strains, Xanthomonas oryzae pv. oryzae (Xoo) PXO35, we illustrate why Illumina short reads and longer PacBio reads are insufficient to fully resolve the genome. While ONT reads are perfectly suited to yield highly contiguous genomes, they suffer from a specific error profile within homopolymers. To still yield complete and correct TALomes from ONT assemblies, we present a computational correction pipeline specifically tailored to TALE genes, which yields at least comparable accuracy as Illumina-based polishing. We further systematically assess the ONT-based pipeline for its multiplexing capacity and find that, combined with computational correction, the complete TALome of Xoo PXO35 could have been reconstructed from less than 20,000 ONT reads.
    Conclusions: Our results indicate that multiplexed ONT sequencing combined with a computational correction of TALE genes constitutes a highly capable tool for characterizing the TALomes of huge collections of Xanthomonas strains in the future.
    MeSH term(s) Nanopore Sequencing ; Transcription Activator-Like Effectors/genetics ; Xanthomonas/genetics ; Genome
    Chemical Substances Transcription Activator-Like Effectors
    Language English
    Publishing date 2023-03-27
    Publishing country England
    Document type Journal Article
    ZDB-ID 2041499-7
    ISSN 1471-2164 ; 1471-2164
    ISSN (online) 1471-2164
    ISSN 1471-2164
    DOI 10.1186/s12864-023-09228-1
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  3. Article: Magnipore: Prediction of differential single nucleotide changes in the Oxford Nanopore Technologies sequencing signal of SARS-CoV-2 samples.

    Spangenberg, Jannes / Zu Siederdissen, Christian Höner / Žarković, Milena / Triebel, Sandra / Rose, Ruben / Christophersen, Christina Martínez / Paltzow, Lea / Hegab, Mohsen M / Wansorra, Anna / Srivastava, Akash / Krumbholz, Andi / Marz, Manja

    bioRxiv : the preprint server for biology

    2023  

    Abstract: Oxford Nanopore Technologies (ONT) allows direct sequencing of ribonucleic acids (RNA) and, in addition, detection of possible RNA modifications due to deviations from the expected ONT signal. The software available so far for this purpose can only ... ...

    Abstract Oxford Nanopore Technologies (ONT) allows direct sequencing of ribonucleic acids (RNA) and, in addition, detection of possible RNA modifications due to deviations from the expected ONT signal. The software available so far for this purpose can only detect a small number of modifications. Alternatively, two samples can be compared for different RNA modifications. We present Magnipore, a novel tool to search for significant signal shifts between samples of Oxford Nanopore data from similar or related species. Magnipore classifies them into mutations and potential modifications. We use Magnipore to compare SARS-CoV-2 samples. Included were representatives of the early 2020s Pango lineages (n=6), samples from Pango lineages B.1.1.7 (n=2, Alpha), B.1.617.2 (n=1, Delta), and B.1.529 (n=7, Omicron). Magnipore utilizes position-wise Gaussian distribution models and a comprehensible significance threshold to find differential signals. In the case of Alpha and Delta, Magnipore identifies 55 detected mutations and 15 sites that hint at differential modifications. We predicted potential virus-variant and variant-group-specific differential modifications. Magnipore contributes to advancing RNA modification analysis in the context of viruses and virus variants.
    Language English
    Publishing date 2023-03-17
    Publishing country United States
    Document type Preprint
    DOI 10.1101/2023.03.17.533105
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  4. Article ; Online: Magnipore: Prediction of differential single nucleotide changes in the Oxford Nanopore Technologies sequencing signal of SARS-CoV-2 samples

    Spangenberg, Jannes / Honer zu Siederdissen, Christian / Zarkovic, Milena / Triebel, Sandra / Rose, Ruben / Martinez Christophersen, Christina Verena / Paltzow, Lea / Hegab, Mohsen Mahmoud / Wansorra, Anna Nora / Srivastava, Akash / Krumbholz, Andi / Marz, Manja

    bioRxiv

    Abstract: Oxford Nanopore Technologies (ONT) allows direct sequencing of ribonucleic acids (RNA) and, in addition, detection of possible RNA modifications due to deviations from the expected ONT signal. The software available so far for this purpose can only ... ...

    Abstract Oxford Nanopore Technologies (ONT) allows direct sequencing of ribonucleic acids (RNA) and, in addition, detection of possible RNA modifications due to deviations from the expected ONT signal. The software available so far for this purpose can only detect a small number of modifications. Alternatively, two samples can be compared for different RNA modifications. We present Magnipore, a novel tool to search for significant signal shifts between samples of Oxford Nanopore data from similar or related species. Magnipore classifies them into mutations and potential modifications. We use Magnipore to compare SARS-CoV-2 samples. Included were representatives of the early 2020s Pango lineages (n=6), samples from Pango lineages B.1.1.7 (n=2, Alpha), B.1.617.2 (n=1, Delta), and B.1.529 (n=7, Omicron). Magnipore utilizes position-wise Gaussian distribution models and a comprehensible significance threshold to find differential signals. In the case of Alpha and Delta, Magnipore identifies 55 detected mutations and 15 sites that hint at differential modifications. We predicted potential virus-variant and variant-group-specific differential modifications. Magnipore contributes to advancing RNA modification analysis in the context of viruses and virus variants.
    Keywords covid19
    Language English
    Publishing date 2023-03-17
    Publisher Cold Spring Harbor Laboratory
    Document type Article ; Online
    DOI 10.1101/2023.03.17.533105
    Database COVID19

    Full text online

    Kategorien

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  5. Article ; Online: Mouse models for hereditary spastic paraplegia uncover a role of PI4K2A in autophagic lysosome reformation.

    Khundadze, Mukhran / Ribaudo, Federico / Hussain, Adeela / Stahlberg, Henry / Brocke-Ahmadinejad, Nahal / Franzka, Patricia / Varga, Rita-Eva / Zarkovic, Milena / Pungsrinont, Thanakorn / Kokal, Miriam / Ganley, Ian G / Beetz, Christian / Sylvester, Marc / Hübner, Christian A

    Autophagy

    2021  Volume 17, Issue 11, Page(s) 3690–3706

    Abstract: Hereditary spastic paraplegia (HSP) denotes genetically heterogeneous disorders characterized by leg spasticity due to degeneration of corticospinal axons. SPG11 and SPG15 have a similar clinical course and together are the most prevalent autosomal ... ...

    Abstract Hereditary spastic paraplegia (HSP) denotes genetically heterogeneous disorders characterized by leg spasticity due to degeneration of corticospinal axons. SPG11 and SPG15 have a similar clinical course and together are the most prevalent autosomal recessive HSP entity. The respective proteins play a role for macroautophagy/autophagy and autophagic lysosome reformation (ALR). Here, we report that
    MeSH term(s) Animals ; Autophagy ; Blotting, Western ; Disease Models, Animal ; Flow Cytometry ; Lysosomes/metabolism ; Mass Spectrometry ; Mice ; Mice, Inbred C57BL ; Mice, Knockout ; Minor Histocompatibility Antigens/metabolism ; Minor Histocompatibility Antigens/physiology ; Phosphotransferases (Alcohol Group Acceptor)/metabolism ; Phosphotransferases (Alcohol Group Acceptor)/physiology ; Proteins/metabolism ; Spastic Paraplegia, Hereditary/metabolism ; Spastic Paraplegia, Hereditary/pathology
    Chemical Substances Minor Histocompatibility Antigens ; Proteins ; SPG11 protein, mouse ; Phosphotransferases (Alcohol Group Acceptor) (EC 2.7.1.-) ; phosphatidylinositol phosphate 4-kinase (EC 2.7.1.67)
    Language English
    Publishing date 2021-03-09
    Publishing country United States
    Document type Journal Article ; Research Support, Non-U.S. Gov't
    ZDB-ID 2454135-7
    ISSN 1554-8635 ; 1554-8627
    ISSN (online) 1554-8635
    ISSN 1554-8627
    DOI 10.1080/15548627.2021.1891848
    Database MEDical Literature Analysis and Retrieval System OnLINE

    Full text online

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 6741: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  6. Article: Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy.

    Ullah, Muhammad I / Ahmad, Arsalan / Zarkovic, Milena / Shah, Syed S / Nasir, Abdul / Mahmood, Saqib / Ahmad, Wasim / Hubner, Christian A / Hassan, Muhammad J

    Saudi medical journal

    2017  Volume 38, Issue 12, Page(s) 1190–1195

    Abstract: Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family.  Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, ... ...

    Abstract Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family.  Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool.  Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM) like elevated serum creatine kinase (CK) levels, distal muscle weakness, myopathic changes in electromyography (EMG) and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT) in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X), which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein.  Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X) in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
    MeSH term(s) Adult ; Distal Myopathies/genetics ; Dysferlin/genetics ; Female ; Gene Duplication ; Humans ; Male ; Muscular Atrophy/genetics ; Mutation ; Pakistan ; Pedigree ; Young Adult
    Chemical Substances DYSF protein, human ; Dysferlin
    Language English
    Publishing date 2017-12-01
    Publishing country Saudi Arabia
    Document type Journal Article
    ZDB-ID 392302-2
    ISSN 1658-3175 ; 0379-5284
    ISSN (online) 1658-3175
    ISSN 0379-5284
    DOI 10.15537/smj.2017.12.20989
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.B 2330: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
    ab Jg. 2022: Lesesaal (EG)
    Zs.MB 6: Show issues

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  7. Article ; Online: Phenotype of non-c.907_909delGAG mutations in TOR1A: DYT1 dystonia revisited.

    Dobričić, Valerija / Kresojević, Nikola / Žarković, Milena / Tomić, Aleksandra / Marjanović, Ana / Westenberger, Ana / Cvetković, Dragana / Svetel, Marina / Novaković, Ivana / Kostić, Vladimir S

    Parkinsonism & related disorders

    2015  Volume 21, Issue 10, Page(s) 1256–1259

    Abstract: Background: In addition to the most frequent TOR1A/DYT1 mutation (c.907_909delGAG), a growing number of TOR1A sequence variants are found in dystonia patients. For most, functional characterization has demonstrated pathogenicity at different levels, ... ...

    Abstract Background: In addition to the most frequent TOR1A/DYT1 mutation (c.907_909delGAG), a growing number of TOR1A sequence variants are found in dystonia patients. For most, functional characterization has demonstrated pathogenicity at different levels, implying that TOR1A genetic testing should not be limited to screening for c.907_909delGAG.
    Methods: We tested 461 Serbian patients with isolated or combined dystonia for changes in the TOR1A gene and performed a systematic literature review of the clinical characteristics of patients carrying TOR1A mutations other than c.907_909delGAG.
    Results: One likely pathogenic TOR1A mutation (c.385G>A, p.Val129Ile) was detected in an adult-onset cervical dystonia patient. This change is in proximity to the previously reported p.Glu121Lys mutation and predicted to decrease the stability of TOR1A-encoded protein TorsinA.
    Conclusions: Our patient and three other reported carriers of non-c.907_909delGAG-mutations within the first three exons of TOR1A showed similar phenotypes of adult-onset focal or segmental cervical dystonia. This observation raises the possibility of genotype-phenotype correlations in DYT1 and indicates that the clinical spectrum of this type of dystonia might be broader then previous classic descriptions.
    MeSH term(s) Adolescent ; Adult ; Aged ; Base Sequence ; Child ; Child, Preschool ; DNA Mutational Analysis ; Dystonic Disorders/genetics ; Female ; Genetic Association Studies ; Genotype ; Humans ; Male ; Middle Aged ; Molecular Chaperones/genetics ; Molecular Sequence Data ; Mutation ; Pedigree ; Phenotype ; Serbia ; Young Adult
    Chemical Substances Molecular Chaperones ; TOR1A protein, human
    Language English
    Publishing date 2015-10
    Publishing country England
    Document type Case Reports ; Journal Article ; Research Support, Non-U.S. Gov't
    ZDB-ID 1311489-x
    ISSN 1873-5126 ; 1353-8020
    ISSN (online) 1873-5126
    ISSN 1353-8020
    DOI 10.1016/j.parkreldis.2015.08.001
    Database MEDical Literature Analysis and Retrieval System OnLINE

    Full text online

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 4553: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (2.OG)
    ab Jg. 2022: Lesesaal (EG)
    Zs.MO 420: Show issues

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

To top