LIVIVO - The Search Portal for Life Sciences

zur deutschen Oberfläche wechseln
Advanced search

Search results

Result 1 - 10 of total 62

Search options

  1. Article ; Online: Theonella

    Festa, Carmen / De Marino, Simona / Zampella, Angela / Fiorucci, Stefano

    Marine drugs

    2023  Volume 21, Issue 5

    Abstract: The marine environment is considered a vast source in the discovery of structurally unique bioactive secondary metabolites. Among marine invertebrates, the ... ...

    Abstract The marine environment is considered a vast source in the discovery of structurally unique bioactive secondary metabolites. Among marine invertebrates, the sponge
    MeSH term(s) Animals ; Humans ; Theonella ; Sterols/pharmacology ; Sterols/chemistry ; Receptors, Cytoplasmic and Nuclear ; Phytosterols
    Chemical Substances Sterols ; Receptors, Cytoplasmic and Nuclear ; Phytosterols
    Language English
    Publishing date 2023-05-08
    Publishing country Switzerland
    Document type Journal Article ; Review
    ZDB-ID 2175190-0
    ISSN 1660-3397 ; 1660-3397
    ISSN (online) 1660-3397
    ISSN 1660-3397
    DOI 10.3390/md21050291
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  2. Article ; Online: Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

    Festa, Carmen / Esposito, Veronica / Benigno, Daniela / De Marino, Simona / Zampella, Angela / Virgilio, Antonella / Galeone, Aldo

    International journal of molecular sciences

    2022  Volume 23, Issue 3

    Abstract: The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'- ...

    Abstract The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (A
    MeSH term(s) Catalysis ; DNA/chemistry ; Deoxyadenosines/chemistry ; G-Quadruplexes ; Humans ; Oligonucleotides/chemistry ; Stereoisomerism ; Telomere
    Chemical Substances Deoxyadenosines ; Oligonucleotides ; 8-bromo-2'-deoxyadenosine (14985-44-5) ; 2'-deoxy-7,8-dihydro-8-oxoadenosine (62471-63-0) ; DNA (9007-49-2)
    Language English
    Publishing date 2022-01-20
    Publishing country Switzerland
    Document type Journal Article
    ZDB-ID 2019364-6
    ISSN 1422-0067 ; 1422-0067 ; 1661-6596
    ISSN (online) 1422-0067
    ISSN 1422-0067 ; 1661-6596
    DOI 10.3390/ijms23031092
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  3. Article: Chemistry and Pharmacology of GPBAR1 and FXR Selective Agonists, Dual Agonists, and Antagonists.

    De Marino, Simona / Festa, Carmen / Sepe, Valentina / Zampella, Angela

    Handbook of experimental pharmacology

    2019  Volume 256, Page(s) 137–165

    Abstract: In the recent years, bile acid receptors FXR and GPBAR1 have attracted the interest of scientific community and companies, as they proved promising targets for the treatment of several diseases, ranging from liver cholestatic disorders to metabolic ... ...

    Abstract In the recent years, bile acid receptors FXR and GPBAR1 have attracted the interest of scientific community and companies, as they proved promising targets for the treatment of several diseases, ranging from liver cholestatic disorders to metabolic syndrome, inflammatory states, nonalcoholic steatohepatitis (NASH), and diabetes.Consequently, the development of dual FXR/GPBAR1 agonists, as well as selective targeting of one of these receptors, is considered a hopeful possibility in the treatment of these disorders. Because endogenous bile acids and steroidal ligands, which cover the same chemical space of bile acids, often target both receptor families, speculation on nonsteroidal ligands represents a promising and innovative strategy to selectively target GPBAR1 or FXR.In this review, we summarize the most recent acquisition on natural, semisynthetic, and synthetic steroidal and nonsteroidal ligands, able to interact with FXR and GPBAR1.
    MeSH term(s) Bile Acids and Salts/chemistry ; Bile Acids and Salts/pharmacology ; Humans ; Ligands ; Receptors, Cytoplasmic and Nuclear/agonists ; Receptors, Cytoplasmic and Nuclear/antagonists & inhibitors ; Receptors, G-Protein-Coupled/agonists ; Receptors, G-Protein-Coupled/antagonists & inhibitors
    Chemical Substances Bile Acids and Salts ; GPBAR1 protein, human ; Ligands ; Receptors, Cytoplasmic and Nuclear ; Receptors, G-Protein-Coupled ; farnesoid X-activated receptor (0C5V0MRU6P)
    Language English
    Publishing date 2019-06-14
    Publishing country Germany
    Document type Journal Article ; Review
    ISSN 0171-2004
    ISSN 0171-2004
    DOI 10.1007/164_2019_237
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Sign. bis Bd. 125 (1997): 1982 A 2146: Show issues
     danach: Sign. bei den Einzelbänden: Show issues

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  4. Article ; Online: Expanding the Library of 1,2,4-Oxadiazole Derivatives: Discovery of New Farnesoid X Receptor (FXR) Antagonists/Pregnane X Receptor (PXR) Agonists.

    Finamore, Claudia / Festa, Carmen / Fiorillo, Bianca / Leva, Francesco Saverio Di / Roselli, Rosalinda / Marchianò, Silvia / Biagioli, Michele / Spinelli, Lucio / Fiorucci, Stefano / Limongelli, Vittorio / Zampella, Angela / De Marino, Simona

    Molecules (Basel, Switzerland)

    2023  Volume 28, Issue 6

    Abstract: Compounds featuring a 1,2,4-oxadiazole core have been recently identified as a new chemotype of farnesoid X receptor (FXR) antagonists. With the aim to expand this class of compounds and to understand the building blocks necessary to maintain the ... ...

    Abstract Compounds featuring a 1,2,4-oxadiazole core have been recently identified as a new chemotype of farnesoid X receptor (FXR) antagonists. With the aim to expand this class of compounds and to understand the building blocks necessary to maintain the antagonistic activity, we describe herein the synthesis, the pharmacological evaluation, and the in vitro pharmacokinetic properties of a novel series of 1,2,4-oxadiazole derivatives decorated on the nitrogen of the piperidine ring with different N-alkyl and N-aryl side chains. In vitro pharmacological evaluation showed compounds
    MeSH term(s) Pregnane X Receptor ; Receptors, Steroid/metabolism ; Receptors, Cytoplasmic and Nuclear ; Molecular Docking Simulation ; Gene Library
    Chemical Substances Pregnane X Receptor ; Receptors, Steroid ; Receptors, Cytoplasmic and Nuclear
    Language English
    Publishing date 2023-03-21
    Publishing country Switzerland
    Document type Journal Article
    ZDB-ID 1413402-0
    ISSN 1420-3049 ; 1431-5165 ; 1420-3049
    ISSN (online) 1420-3049
    ISSN 1431-5165 ; 1420-3049
    DOI 10.3390/molecules28062840
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.MO 81: Show issues

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  5. Article: Synergism of a Novel 1,2,4-oxadiazole-containing Derivative with Oxacillin against Methicillin-Resistant

    Buommino, Elisabetta / De Marino, Simona / Sciarretta, Martina / Piccolo, Marialuisa / Festa, Carmen / D'Auria, Maria Valeria

    Antibiotics (Basel, Switzerland)

    2021  Volume 10, Issue 10

    Abstract: ... ...

    Abstract Staphylococcus
    Language English
    Publishing date 2021-10-16
    Publishing country Switzerland
    Document type Journal Article
    ZDB-ID 2681345-2
    ISSN 2079-6382
    ISSN 2079-6382
    DOI 10.3390/antibiotics10101258
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  6. Article: Phytochemical Analysis of the Methanolic Extract and Essential Oil from Leaves of Industrial Hemp Futura 75 Cultivar: Isolation of a New Cannabinoid Derivative and Biological Profile Using Computational Approaches

    De Vita, Simona / Finamore, Claudia / Chini, Maria Giovanna / Saviano, Gabriella / De Felice, Vincenzo / De Marino, Simona / Lauro, Gianluigi / Casapullo, Agostino / Fantasma, Francesca / Trombetta, Federico / Bifulco, Giuseppe / Iorizzi, Maria

    Plants. 2022 June 24, v. 11, no. 13

    2022  

    Abstract: Cannabis sativa L. is a plant belonging to the Cannabaceae family, cultivated for its psychoactive cannabinoid (Δ⁹-THC) concentration or for its fiber and nutrient content in industrial use. Industrial hemp shows a low Δ⁹-THC level and is a valuable ... ...

    Abstract Cannabis sativa L. is a plant belonging to the Cannabaceae family, cultivated for its psychoactive cannabinoid (Δ⁹-THC) concentration or for its fiber and nutrient content in industrial use. Industrial hemp shows a low Δ⁹-THC level and is a valuable source of phytochemicals, mainly represented by cannabinoids, flavones, terpenes, and alkaloids, with health-promoting effects. In the present study, we investigated the phytochemical composition of leaves of the industrial hemp cultivar Futura 75, a monoecious cultivar commercially used for food preparations or cosmetic purposes. Leaves are generally discarded, and represent waste products. We analyzed the methanol extract of Futura 75 leaves by HPLC and NMR spectroscopy and the essential oil by GC-MS. In addition, in order to compare the chemical constituents, we prepared the water infusion. One new cannabinoid derivative (1) and seven known components, namely, cannabidiol (2), cannabidiolic acid (3), β-cannabispirol (4), β-cannabispirol (5), canniprene (6), cannabiripsol (7), and cannflavin B (8) were identified. The content of CBD was highest in all preparations. In addition, we present the outcomes of a computational study focused on elucidating the role of 2α-hydroxy-Δ³,⁷-cannabitriol (1), CBD (2), and CBDA (3) in inflammation and thrombogenesis.
    Keywords Cannabis sativa ; cannabidiol ; chemical constituents of plants ; cultivars ; essential oils ; flavones ; health promotion ; hemp ; inflammation ; methanol ; monoecy ; nuclear magnetic resonance spectroscopy ; nutrient content ; terpenoids
    Language English
    Dates of publication 2022-0624
    Publishing place Multidisciplinary Digital Publishing Institute
    Document type Article
    ZDB-ID 2704341-1
    ISSN 2223-7747
    ISSN 2223-7747
    DOI 10.3390/plants11131671
    Database NAL-Catalogue (AGRICOLA)

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  7. Article: Phytochemical Analysis of the Methanolic Extract and Essential Oil from Leaves of Industrial Hemp

    De Vita, Simona / Finamore, Claudia / Chini, Maria Giovanna / Saviano, Gabriella / De Felice, Vincenzo / De Marino, Simona / Lauro, Gianluigi / Casapullo, Agostino / Fantasma, Francesca / Trombetta, Federico / Bifulco, Giuseppe / Iorizzi, Maria

    Plants (Basel, Switzerland)

    2022  Volume 11, Issue 13

    Abstract: ... Cannabis ... ...

    Abstract Cannabis sativa
    Language English
    Publishing date 2022-06-24
    Publishing country Switzerland
    Document type Journal Article
    ZDB-ID 2704341-1
    ISSN 2223-7747
    ISSN 2223-7747
    DOI 10.3390/plants11131671
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  8. Article ; Online: Biological Profile of Two

    De Vita, Simona / Chini, Maria Giovanna / Saviano, Gabriella / Finamore, Claudia / Festa, Carmen / Lauro, Gianluigi / De Marino, Simona / Russo, Roberto / Avagliano, Carmen / Casapullo, Agostino / Calignano, Antonio / Bifulco, Giuseppe / Iorizzi, Maria

    Biomolecules

    2021  Volume 11, Issue 10

    Abstract: Natural products have been the main source of bioactive molecules for centuries. We tested the biological profile of two metabolites extracted ... ...

    Abstract Natural products have been the main source of bioactive molecules for centuries. We tested the biological profile of two metabolites extracted from
    MeSH term(s) Animals ; Cell Line ; Computational Biology ; Cyclooxygenase 2/metabolism ; Doxycycline/chemistry ; Doxycycline/pharmacology ; Drug Evaluation, Preclinical ; Gentiana/metabolism ; In Vitro Techniques ; Iridoid Glucosides/chemistry ; Iridoid Glucosides/pharmacology ; Iridoids/chemistry ; Iridoids/pharmacology ; Ligands ; Metabolome ; Mice ; Molecular Docking Simulation ; Molecular Dynamics Simulation ; Proteins/chemistry
    Chemical Substances Iridoid Glucosides ; Iridoids ; Ligands ; Proteins ; gentiopicroside (0WE09Z21RC) ; loganic acid (22255-40-9) ; Cyclooxygenase 2 (EC 1.14.99.1) ; Doxycycline (N12000U13O)
    Language English
    Publishing date 2021-10-09
    Publishing country Switzerland
    Document type Journal Article ; Research Support, Non-U.S. Gov't
    ZDB-ID 2701262-1
    ISSN 2218-273X ; 2218-273X
    ISSN (online) 2218-273X
    ISSN 2218-273X
    DOI 10.3390/biom11101490
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  9. Article ; Online: Structure-based screening for the discovery of 1,2,4-oxadiazoles as promising hits for the development of new anti-inflammatory agents interfering with eicosanoid biosynthesis pathways.

    Potenza, Marianna / Sciarretta, Martina / Chini, Maria Giovanna / Saviano, Anella / Maione, Francesco / D'Auria, Maria Valeria / De Marino, Simona / Giordano, Assunta / Hofstetter, Robert Klaus / Festa, Carmen / Werz, Oliver / Bifulco, Giuseppe

    European journal of medicinal chemistry

    2021  Volume 224, Page(s) 113693

    Abstract: The multiple inhibition of biological targets involved in pro-inflammatory eicosanoid biosynthesis represents an innovative strategy for treating inflammatory disorders in light of higher efficacy and safety. Herein, following a multidisciplinary ... ...

    Abstract The multiple inhibition of biological targets involved in pro-inflammatory eicosanoid biosynthesis represents an innovative strategy for treating inflammatory disorders in light of higher efficacy and safety. Herein, following a multidisciplinary protocol involving virtual combinatorial screening, chemical synthesis, and in vitro and in vivo validation of the biological activities, we report the identification of 1,2,4-oxadiazole-based eicosanoid biosynthesis multi-target inhibitors. The multidisciplinary scientific approach led to the identification of three 1,2,4-oxadiazole hits (compounds 1, 2 and 5), all endowed with IC
    MeSH term(s) Animals ; Anti-Inflammatory Agents, Non-Steroidal/chemical synthesis ; Anti-Inflammatory Agents, Non-Steroidal/chemistry ; Anti-Inflammatory Agents, Non-Steroidal/pharmacology ; Arachidonate 5-Lipoxygenase/metabolism ; Cell Line ; Cell Survival/drug effects ; Cyclooxygenase 1/metabolism ; Dose-Response Relationship, Drug ; Drug Development ; Drug Evaluation, Preclinical ; Eicosanoids/biosynthesis ; Enzyme Inhibitors/chemical synthesis ; Enzyme Inhibitors/chemistry ; Enzyme Inhibitors/pharmacology ; Humans ; Male ; Mice ; Molecular Structure ; Oxadiazoles/chemical synthesis ; Oxadiazoles/chemistry ; Oxadiazoles/pharmacology ; Peritonitis/chemically induced ; Peritonitis/drug therapy ; Prostaglandin-E Synthases/antagonists & inhibitors ; Prostaglandin-E Synthases/metabolism ; Structure-Activity Relationship ; Zymosan
    Chemical Substances Anti-Inflammatory Agents, Non-Steroidal ; Eicosanoids ; Enzyme Inhibitors ; Oxadiazoles ; Zymosan (9010-72-4) ; Arachidonate 5-Lipoxygenase (EC 1.13.11.34) ; Cyclooxygenase 1 (EC 1.14.99.1) ; Prostaglandin-E Synthases (EC 5.3.99.3)
    Language English
    Publishing date 2021-07-13
    Publishing country France
    Document type Journal Article
    ZDB-ID 188597-2
    ISSN 1768-3254 ; 0009-4374 ; 0223-5234
    ISSN (online) 1768-3254
    ISSN 0009-4374 ; 0223-5234
    DOI 10.1016/j.ejmech.2021.113693
    Database MEDical Literature Analysis and Retrieval System OnLINE

    Full text online

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.B 784: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  10. Article: Wound healing activity and phytochemical screening of purified fractions of Sempervivum tectorum L. leaves on HCT 116

    Cattaneo, Fabio / De Marino, Simona / Parisi, Melania / Festa, Carmen / Castaldo, Martina / Finamore, Claudia / Duraturo, Francesca / Zollo, Cristiana / Ammendola, Rosario / Zollo, Franco / Iorizzi, Maria

    Phytochemical analysis. 2019 Sept., v. 30, no. 5

    2019  

    Abstract: INTRODUCTION: Sempervivum tectorum L. (Crassulaceae), is a succulent perennial plant widespread in Mediterranean countries and commonly used in traditional medicine for ear inflammation, ulcers and skin rashes as a refrigerant and astringent. OBJECTIVE: ... ...

    Abstract INTRODUCTION: Sempervivum tectorum L. (Crassulaceae), is a succulent perennial plant widespread in Mediterranean countries and commonly used in traditional medicine for ear inflammation, ulcers and skin rashes as a refrigerant and astringent. OBJECTIVE: To demonstrate the therapeutic effects of the plant, various fractions were purified and characterised. The potential wound healing activity, proliferation rate and intracellular signalling cascades were investigated by using human epithelial colorectal carcinoma (HCT 116) cells. METHODOLOGY: An extraction method without organic solvents was applied for the first time. The purification was carried out by droplet counter current chromatography (DCCC) coupled with high‐performance liquid chromatography (HPLC) and electrospray ionisation mass spectrometry (ESI‐MS) data. By nuclear magnetic resonance (NMR) [1H, 13C and two‐dimensional (2D) experiments] pure components were identified. Wound healing and cell proliferation assays were utilised to determine the role of the isolated S. tectorum (SVT) fraction on cellular migration and proliferation. The signalling pathways elicited from the SVT fractions, were analysed by Western blot analysis. RESULTS: In this study two rare natural components were identified, namely monosaccharide sedoheptulose and polyalcohol 2‐C‐methyl‐D‐erythritol, along with known organic acids and flavonoids. The fractions with high level of sedoheptulose enhance the proliferation and the cellular migration of epithelial HCT 116 cells. The intracellular signalling cascades elicited from the purified fractions induce the c‐Src‐mediated transactivation of EGFR and the activation of the STAT3 pathway which, in turn, are crucially involved in the cellular proliferation and migration. CONCLUSIONS: Our study demonstrates the efficacy of purified fractions of S. tectorum L. in enhancing cellular proliferation and migration, suggesting their potential role as topical therapeutic treatments for wound healing.
    Keywords Sempervivum tectorum ; Western blotting ; cell movement ; cell proliferation ; chemical constituents of plants ; colorectal neoplasms ; countercurrent chromatography ; droplets ; ears ; electrospray ionization mass spectrometry ; epithelium ; flavonoids ; high performance liquid chromatography ; humans ; inflammation ; nuclear magnetic resonance spectroscopy ; organic acids and salts ; perennials ; signal transduction ; solvents ; therapeutics ; tissue repair ; traditional medicine ; transcriptional activation ; Mediterranean region
    Language English
    Dates of publication 2019-09
    Size p. 524-534.
    Publishing place John Wiley & Sons, Ltd
    Document type Article
    Note JOURNAL ARTICLE
    ZDB-ID 1073576-8
    ISSN 1099-1565 ; 0958-0344
    ISSN (online) 1099-1565
    ISSN 0958-0344
    DOI 10.1002/pca.2844
    Database NAL-Catalogue (AGRICOLA)

    Full text online

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 4608: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (2.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

To top