LIVIVO - The Search Portal for Life Sciences

zur deutschen Oberfläche wechseln
Advanced search

Search results

Result 1 - 10 of total 424

Search options

  1. Book ; Online ; E-Book: Molecular oncology

    Farooqi, Ammad Ahmad / Ismail, Muhammad

    underlying mechanisms and translational advancements

    2017  

    Author's details edited by Ammad Ahmad Farooqi, Muhammad Ismail
    Keywords Medicine ; Cancer research ; Oncology
    Subject code 614.5999
    Language English
    Size 1 Online-Ressource (x, 300 Seiten), Illustrationen
    Publisher Springer
    Publishing place Cham
    Publishing country Switzerland
    Document type Book ; Online ; E-Book
    Remark Zugriff für angemeldete ZB MED-Nutzerinnen und -Nutzer
    HBZ-ID HT019377754
    ISBN 978-3-319-53082-6 ; 9783319530819 ; 3-319-53082-8 ; 331953081X
    DOI 10.1007/978-3-319-53082-6
    Database ZB MED Catalogue: Medicine, Health, Nutrition, Environment, Agriculture

    Full text online

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  2. Article: Enhancing sustainability through resource efficiency in beef production systems using a sliding time window-based approach and frame scores.

    Ismail, Muhammad / Al-Ansari, Tareq

    Heliyon

    2023  Volume 9, Issue 7, Page(s) e17773

    Abstract: The food needs of the increasing global population, inefficiencies in supply chains, customer expectations and environmental concerns are the challenges to meeting resource-intensive protein needs sustainably. Collectively, this increases the need to ... ...

    Abstract The food needs of the increasing global population, inefficiencies in supply chains, customer expectations and environmental concerns are the challenges to meeting resource-intensive protein needs sustainably. Collectively, this increases the need to enhance sustainability in the beef sector. This study proposes a sliding time-window-based multi-period livestock production model using mixed-integer linear programming (MILP) to simultaneously balance economic and environmental losses. It identifies the optimal finishing time using frame score (FS) and feed conversion ratio (FCR), targeting flexibility by allowing variable growth periods to reduce food/nutritional losses while meeting the variability in demands with minimum inventory levels. Furthermore, sequencing and assigning animals to facilities with optimum separation time is applied to avoid bad handling of animals and ensure quality meat with hygienic standards for longer shelf life. The system boundary of the proposed model includes beef farms and processing facilities. Compared to the recently proposed batch processing models over seven months with a herd size of 1980 animals, the findings reduce the average forage needed by ∼126.90 kips and methane emissions by ∼2560 kg, with a significant benefit in terms of the live animals' weight gain by ∼10,276 lbs.
    Language English
    Publishing date 2023-07-04
    Publishing country England
    Document type Journal Article
    ZDB-ID 2835763-2
    ISSN 2405-8440
    ISSN 2405-8440
    DOI 10.1016/j.heliyon.2023.e17773
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  3. Article: How has rural tourism influenced the sustainable development of traditional villages? A systematic literature review.

    Yanan, Li / Ismail, Muhammad Azzam / Aminuddin, Asrul

    Heliyon

    2024  Volume 10, Issue 4, Page(s) e25627

    Abstract: Rural tourism has been widely recognized as a means of promoting the revival of traditional villages and has been supported by numerous researchers. It has the potential to provide significant social and economic advantages, making it a popular strategy ... ...

    Abstract Rural tourism has been widely recognized as a means of promoting the revival of traditional villages and has been supported by numerous researchers. It has the potential to provide significant social and economic advantages, making it a popular strategy for rural development in both developed and developing countries. Nevertheless, a growing body of research has substantiated the significant disruptions that rural tourism has imposed on traditional villages. This study employed the PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analyses) qualitative method to systematically analyze 92 papers from WOS and SCOPUS that investigate the impact of rural tourism on traditional villages. The papers were categorized into five groups: spatial, economic, sociocultural, and holistic. This categorization allowed for the identification of the purpose, theme, sub-topics, research methods, and data sources used in these papers, which in turn provided an overview of the characteristics and overall trends in research in this field. It compensates for the deficiencies of lesser reviews that just emphasize rural tourism as the primary catalyst for the sustainable development of traditional villages. Based on a thorough investigation, this paper asserts that the development of tourism in traditional villages should be differentiated from typical rural tourism sites that prioritize the preferences of tourists. The primary objective should be to prioritize the preservation of community values, with a strong emphasis on community participation. This should be done while considering the interests of various stakeholders and promoting a diverse range of livelihoods that are rooted in traditional practices. By doing so, the essence of authenticity in traditional villages can be reinforced, leading to a greater sense of connection and loyalty among tourists. The preservation of traditional village genes fosters a symbiotic relationship with rural tourism, resulting in a mutually beneficial cycle.
    Language English
    Publishing date 2024-02-05
    Publishing country England
    Document type Journal Article ; Review
    ZDB-ID 2835763-2
    ISSN 2405-8440
    ISSN 2405-8440
    DOI 10.1016/j.heliyon.2024.e25627
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  4. Article: Increased Vulnerability to Ferroptosis in FUS-ALS.

    Ismail, Muhammad / Großmann, Dajana / Hermann, Andreas

    Biology

    2024  Volume 13, Issue 4

    Abstract: Ferroptosis, a regulated form of cell death characterized by iron-dependent lipid peroxide accumulation, plays a pivotal role in various pathological conditions, including neurodegenerative diseases. While reasonable evidence for ferroptosis exists, e.g., ...

    Abstract Ferroptosis, a regulated form of cell death characterized by iron-dependent lipid peroxide accumulation, plays a pivotal role in various pathological conditions, including neurodegenerative diseases. While reasonable evidence for ferroptosis exists, e.g., in Parkinson's disease or Alzheimer's disease, there are only a few reports on amyotrophic lateral sclerosis (ALS), a fast progressive and incurable neurodegenerative disease characterized by progressive motor neuron degeneration. Interestingly, initial studies have suggested that ferroptosis might be significantly involved in ALS. Key features of ferroptosis include oxidative stress, glutathione depletion, and alterations in mitochondrial morphology and function, mediated by proteins such as GPX4, xCT, ACSL4 FSP1, Nrf2, and TfR1. Induction of ferroptosis involves small molecule compounds like erastin and RSL3, which disrupt system Xc
    Language English
    Publishing date 2024-03-26
    Publishing country Switzerland
    Document type Journal Article
    ZDB-ID 2661517-4
    ISSN 2079-7737
    ISSN 2079-7737
    DOI 10.3390/biology13040215
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  5. Article ; Online: Continuation of post-coital intrauterine contraceptive devices beyond index cycle at Sexual Health Sheffield.

    Hepplewhite, Jessica / Ismail, Muhammad Azam

    Sexual & reproductive healthcare : official journal of the Swedish Association of Midwives

    2022  Volume 32, Page(s) 100730

    Abstract: We aimed to observe the continuation of Emergency IUD beyond the index cycle and reasons for removal. We analysed data from the patients' electronic records of fifty consecutive women who had an IUD fitted at Sexual Health Sheffield for emergency ... ...

    Abstract We aimed to observe the continuation of Emergency IUD beyond the index cycle and reasons for removal. We analysed data from the patients' electronic records of fifty consecutive women who had an IUD fitted at Sexual Health Sheffield for emergency contraception. 48 (96%) women continued with the IUD beyond the index cycle and 31 (62%) women for more than 1 year. Heavy menstrual bleeding, dysmenorrhoea and pain were the most frequent reasons cited for removal.
    MeSH term(s) Dysmenorrhea ; Female ; Humans ; Intrauterine Devices ; Intrauterine Devices, Copper ; Male ; Sexual Health
    Language English
    Publishing date 2022-04-26
    Publishing country Netherlands
    Document type Journal Article
    ZDB-ID 2541869-5
    ISSN 1877-5764 ; 1877-5756
    ISSN (online) 1877-5764
    ISSN 1877-5756
    DOI 10.1016/j.srhc.2022.100730
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  6. Article: Neuroradiological Correlation of the Lateral Third Periventricular, Pituitary Gland and Stalk, Pineal Gland, Cerebral Aqueduct, and Foramen Magendie and Luschka With Intraventricular Neuroendoscopic Images: A Case Series.

    Zakaria, Zaitun / Ismail, Muhammad Ihfaz / Ang, Song Yee / Idris, Zamzuri

    Cureus

    2024  Volume 16, Issue 3, Page(s) e56952

    Abstract: Neuroendoscopy procedures in pediatrics have expanded beyond the endoscopic third ventriculostomy. As such, a direct and angled endoscope allows further visualization around the corner, capturing the surrounding anatomy. Intraoperative live images look ... ...

    Abstract Neuroendoscopy procedures in pediatrics have expanded beyond the endoscopic third ventriculostomy. As such, a direct and angled endoscope allows further visualization around the corner, capturing the surrounding anatomy. Intraoperative live images look different than radiological images. Hence, in this single institutional experience, we correlate neuroradiology images with intraoperative intraventricular endoscopic views of the third-fourth ventricle, pituitary, pineal gland, cerebral aqueduct, and foramen magendie and luschka. Our collective case series reveals a few interesting case scenarios of normal and abnormal findings during the procedure. Careful navigation of the neuroendoscope is crucial to prevent injury to the neurovascular bundle. A close relationship with normal anatomy from radiological imaging is necessary to prevent it from getting lost once inside the ventricular cavity.
    Language English
    Publishing date 2024-03-26
    Publishing country United States
    Document type Journal Article
    ZDB-ID 2747273-5
    ISSN 2168-8184
    ISSN 2168-8184
    DOI 10.7759/cureus.56952
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  7. Article: SnO

    Ismail, Muhammad / Mahata, Chandreswar / Kang, Myounggon / Kim, Sungjun

    Nanomaterials (Basel, Switzerland)

    2023  Volume 13, Issue 18

    Abstract: In this study, we fabricate a Pt/TiN/ ... ...

    Abstract In this study, we fabricate a Pt/TiN/SnO
    Language English
    Publishing date 2023-09-21
    Publishing country Switzerland
    Document type Journal Article
    ZDB-ID 2662255-5
    ISSN 2079-4991
    ISSN 2079-4991
    DOI 10.3390/nano13182603
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  8. Article ; Online: Linkage disequilibrium block single-nucleotide polymorphisms in FTO alpha ketoglutarate dependent dioxygenase gene inference with breast cancer and Type II diabetes in Pakistani female population.

    Mansoor, Qaisar / Ismail, Muhammad / Ali Ul Qader, Shah

    PloS one

    2023  Volume 18, Issue 7, Page(s) e0288934

    Abstract: Breast Cancer and Diabetes Mellitus are top ranked non-communicable life threatening diseases concerned in South Asia. The growing scientific clues witness the involvement of genetic variations which readily serve as risk factors for the disease onset. ... ...

    Abstract Breast Cancer and Diabetes Mellitus are top ranked non-communicable life threatening diseases concerned in South Asia. The growing scientific clues witness the involvement of genetic variations which readily serve as risk factors for the disease onset. Comprehending the association of genetic predictors and risk factors in the conserved genome regions can help reveal underlying disease genetics and identify the sustained druggable targets. The present study aims to identify discrete inference of FTO alpha-ketoglutarate dependent dioxygenase gene linkage disequilibrium block SNPs rs9940128 and rs9939609 as prognostic genetic elements in defining the disease course either as BrC or NIDDM in Pakistani population. Clinically abreast female Breast Cancer and Type II (Non-Insulin Dependent) Diabetes Mellitus cases with the healthy controls participated in the study. The genomic study was established on the DNA of cases and controls through Tetra primers ARMS PCR and PCR-RFLP; data were analyzed statistically to reach comprehensive scientific annotation. Breast Cancer incidence was high in post menopause women. Fretful cholesterol, triglycerides, hypertension, sugar profiles and high incidence in females was evident in Type II (Non-Insulin Dependent) Diabetes Mellitus. BMI and family history were meager factor for either of the diseases. FTO gene alpha-ketoglutarate dependent dioxygenase linkage disequilibrium block Single-Nucleotide Polymorphism rs9939609 and rs9940128 threating inference was significant in the cancer and diabetes subjects correspondingly. The conclusion indicates serious clinical derailments in breast cancer and Type II (Non-Insulin Dependent) Diabetes Mellitus auxiliary to disease complication in genetically risk bearing FTO alpha-ketoglutarate dependent dioxygenase gene haplotype/linkage disequilibrium block SNPs prevailing in the affected Pakistani population. These clinical and genetic indicators could decisively be adopted in health care practice to intervene the sky rising disease incidence.
    MeSH term(s) Humans ; Female ; Polymorphism, Single Nucleotide ; Diabetes Mellitus, Type 2/epidemiology ; Diabetes Mellitus, Type 2/genetics ; Alpha-Ketoglutarate-Dependent Dioxygenase FTO/genetics ; Linkage Disequilibrium ; Breast Neoplasms/epidemiology ; Breast Neoplasms/genetics ; Pakistan/epidemiology ; Ketoglutaric Acids ; Genetic Predisposition to Disease ; Body Mass Index
    Chemical Substances Alpha-Ketoglutarate-Dependent Dioxygenase FTO (EC 1.14.11.33) ; Ketoglutaric Acids ; FTO protein, human (EC 1.14.11.33)
    Language English
    Publishing date 2023-07-20
    Publishing country United States
    Document type Journal Article
    ZDB-ID 2267670-3
    ISSN 1932-6203 ; 1932-6203
    ISSN (online) 1932-6203
    ISSN 1932-6203
    DOI 10.1371/journal.pone.0288934
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  9. Book ; Online: Secured Quantum Identity Authentication Protocol for Quantum Networks

    Shaban, Mohamed / Ismail, Muhammad

    2023  

    Abstract: Quantum Internet signifies a remarkable advancement in communication technology, harnessing the principles of quantum entanglement and superposition to facilitate unparalleled levels of security and efficient computations. Quantum communication can be ... ...

    Abstract Quantum Internet signifies a remarkable advancement in communication technology, harnessing the principles of quantum entanglement and superposition to facilitate unparalleled levels of security and efficient computations. Quantum communication can be achieved through the utilization of quantum entanglement. Through the exchange of entangled pairs between two entities, quantum communication becomes feasible, enabled by the process of quantum teleportation. Given the lossy nature of the channels and the exponential decoherence of the transmitted photons, a set of intermediate nodes can serve as quantum repeaters to perform entanglement swapping and directly entangle two distant nodes. Such quantum repeaters may be malicious and by setting up malicious entanglements, intermediate nodes can jeopardize the confidentiality of the quantum information exchanged between the two communication nodes. Hence, this paper proposes a quantum identity authentication protocol that protects quantum networks from malicious entanglements. Unlike the existing protocols, the proposed quantum authentication protocol does not require periodic refreshments of the shared secret keys. Simulation results demonstrate that the proposed protocol can detect malicious entanglements with a 100% probability after an average of 4 authentication rounds.
    Keywords Quantum Physics ; Computer Science - Cryptography and Security ; Computer Science - Networking and Internet Architecture
    Subject code 190
    Publishing date 2023-12-10
    Publishing country us
    Document type Book ; Online
    Database BASE - Bielefeld Academic Search Engine (life sciences selection)

    Full text online

    More links

    Kategorien

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  10. Article ; Online: Comparative Analysis of the Effectiveness of Polymerase Chain Reaction and Microscopy in Malaria Diagnosis

    Ismail Muhammad / Tanko Mahmoud Mohammed / Asiya Muhammad Usman / Bala Abubakar

    Traektoriâ Nauki, Vol 9, Iss 1, Pp 6001-

    2023  Volume 6009

    Abstract: Malaria is a life-threatening parasitic disease which causes enormous morbidity and mortality in tropical African countries. Successful prevention and treatment of infected individuals heavenly depend on successful diagnosis using recommended techniques. ...

    Abstract Malaria is a life-threatening parasitic disease which causes enormous morbidity and mortality in tropical African countries. Successful prevention and treatment of infected individuals heavenly depend on successful diagnosis using recommended techniques. These routine laboratory techniques have different performance indices. Therefore, this study aimed to evaluate the performance of Polymerase Chain Reaction and Microscopy in malaria diagnosis. A total of two hundred consented study subjects were randomly selected and enrolled for the research. Vein puncture technique was use to collect venus blood from the subjects and analysed using microscopy and Polymerase chain Reaction. DNA samples were extracted using Quick-DNA™ Miniprep Plus Kit with catalogue No. D4069. 18SrRNA gene of Plasmodium falciparum from chromosome 13 was amplified using the primers F5’AACAGACGGGTAGTCATGATTGAG3’ R5’GTATCTGATCGTCTTCACTCCC3’. Malaria prevalence of 167(83.50%) and 105(52.5%) were recorded using microscopy and Polymerase Chain Reaction. Microscopy had a sensitivity, specificity, Positive predictive value and negative predictive value of 84.91, 23.40, 55.53 and 57.89%, respectively, with an overall accuracy value of 0.81. Polymerase Chain Reaction had a sensitivity value of 53.89%, specificity of 54.54%, positive predictive value of 85.79% and Negative predictive value of 18.94% with an overall accuracy of 0.54. Microscopy and Polymerase Chain Reaction demonstrated significant accuracy and relatively good performance indices. Therefore Microscopy and Polymerase Chain Reaction are highly recommended as malaria diagnostic techniques, and further research should be carried out to determine the influence of some biological factors of both the parasite and the host on the outcome of the diagnosis using both Polymerase Chain Reaction and microscopy.
    Keywords malaria diagnosis ; polymerase chain reaction ; microscopy ; sensitivity ; specificity ; accuracy ; Science ; Q
    Subject code 669
    Language English
    Publishing date 2023-01-01T00:00:00Z
    Publisher Altezoro s.r.o. (Slovak Republic) and Publishing Center "Dialog" (Ukraine)
    Document type Article ; Online
    Database BASE - Bielefeld Academic Search Engine (life sciences selection)

    Full text online

    More links

    Kategorien

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

To top