LIVIVO - The Search Portal for Life Sciences

zur deutschen Oberfläche wechseln
Advanced search

Search results

Result 1 - 4 of total 4

Search options

  1. Article ; Online: A Thermodynamic Study of Adenine and Thymine Substitutions in the Loops of the Oligodeoxyribonucleotide HTel.

    Li, Yang Yun / Macgregor, Robert B

    The journal of physical chemistry. B

    2016  Volume 120, Issue 34, Page(s) 8830–8836

    Abstract: Guanine-rich DNA oligodeoxyribonucleotides (ODN) can form four-stranded structures named quadruplexes (G4s), which are stabilized via the association of four guanine bases. Quadruplexes have a high level of conformational diversity depending on the ... ...

    Abstract Guanine-rich DNA oligodeoxyribonucleotides (ODN) can form four-stranded structures named quadruplexes (G4s), which are stabilized via the association of four guanine bases. Quadruplexes have a high level of conformational diversity depending on the molecularity, sequence, and the cation conditions of the G4 formation. Monomolecular G4 structures have nonguanine loops that usually consist of between one and four adenine and thymine residues. In the work reported here, we systematically modified the nucleotides in the loops of the 22 nucleotide ODN, HTel, which contains four repeats of the human telomeric sequence, GGGTTA. We studied the effect of different types of bases in the loops on the stability and topology of the G4s formed. We show that lower steric hindrance of pyrimidine residues increases the stability of G4s with a major enthalpic contribution. Stacking of the loop bases onto tetrads could compensate for the loss of rotational freedom. In addition, in the presence of sodium, the stabilities of the G4s are loop dependent. In the presence of potassium, the stability of G4 depend on the sequences of each loop. Lastly, in the presence of potassium ions, the modified HTel ODNs may exist in equilibrium of the two types of the hybrid topology, and these structures are stabilized by the second loop. Modifications of the bases in this loop change the topology and stability of the folded structures.
    Language English
    Publishing date 2016-09-01
    Publishing country United States
    Document type Journal Article
    ISSN 1520-5207
    ISSN (online) 1520-5207
    DOI 10.1021/acs.jpcb.6b05601
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  2. Article: A Thermodynamic Study of Adenine and Thymine Substitutions in the Loops of the Oligodeoxyribonucleotide HTel

    Li, Yang Yun / Macgregor Robert B

    Journal of physical chemistry. 2016 Sept. 01, v. 120, no. 34

    2016  

    Abstract: Guanine-rich DNA oligodeoxyribonucleotides (ODN) can form four-stranded structures named quadruplexes (G4s), which are stabilized via the association of four guanine bases. Quadruplexes have a high level of conformational diversity depending on the ... ...

    Abstract Guanine-rich DNA oligodeoxyribonucleotides (ODN) can form four-stranded structures named quadruplexes (G4s), which are stabilized via the association of four guanine bases. Quadruplexes have a high level of conformational diversity depending on the molecularity, sequence, and the cation conditions of the G4 formation. Monomolecular G4 structures have nonguanine loops that usually consist of between one and four adenine and thymine residues. In the work reported here, we systematically modified the nucleotides in the loops of the 22 nucleotide ODN, HTel, which contains four repeats of the human telomeric sequence, GGGTTA. We studied the effect of different types of bases in the loops on the stability and topology of the G4s formed. We show that lower steric hindrance of pyrimidine residues increases the stability of G4s with a major enthalpic contribution. Stacking of the loop bases onto tetrads could compensate for the loss of rotational freedom. In addition, in the presence of sodium, the stabilities of the G4s are loop dependent. In the presence of potassium, the stability of G4 depend on the sequences of each loop. Lastly, in the presence of potassium ions, the modified HTel ODNs may exist in equilibrium of the two types of the hybrid topology, and these structures are stabilized by the second loop. Modifications of the bases in this loop change the topology and stability of the folded structures.
    Keywords DNA ; adenine ; cations ; guanine ; humans ; oligodeoxyribonucleotides ; physical chemistry ; potassium ; sodium ; telomeres ; thermodynamics ; thymine ; topology
    Language English
    Dates of publication 2016-0901
    Size p. 8830-8836.
    Publishing place American Chemical Society
    Document type Article
    ISSN 1520-5207
    DOI 10.1021%2Facs.jpcb.6b05601
    Database NAL-Catalogue (AGRICOLA)

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  3. Article ; Online: Concentration-dependent conformational changes in GQ-forming ODNs.

    Li, Yang Yun / Abu-Ghazalah, Rashid / Zamiri, Bita / Macgregor, Robert B

    Biophysical chemistry

    2016  Volume 211, Page(s) 70–75

    Abstract: Guanine-rich oligodeoxyribonucleotides (ODNs) can form non-canonical DNA structures known as G-quadruplexes, which are four stranded structures stabilized by sodium or potassium cations. The topologies of G-quadruplexes are highly polymorphic. H-Tel, an ... ...

    Abstract Guanine-rich oligodeoxyribonucleotides (ODNs) can form non-canonical DNA structures known as G-quadruplexes, which are four stranded structures stabilized by sodium or potassium cations. The topologies of G-quadruplexes are highly polymorphic. H-Tel, an ODN with four consecutive repeats of the human telomeric sequence, [d(AGGGTTAGGGTTAGGGTTAGGG)], can assume different monomolecular G-quadruplex topologies depending on the type of cation present in solution. Our previous work demonstrated that at high concentrations of H-Tel, the monomolecular G-quadruplexes formed by H-Tel self-associate to form higher order structures. The aggregates display circular dichroism (CD) spectra similar to that of an all-parallel structure. In the current work, we present data for 19 ODNs for which we have modified the loop sequences of H-Tel in order to learn if concentration-dependent self-aggregation is a general phenomenon and to probe the contribution of the loops to the self-association of these ODNs. Our studies use CD spectroscopy and spectroscopically monitored heat denaturation. Our data show that the concentration-dependent formation of parallel G-quadruplex aggregates is a general phenomenon. We propose that one of the factors that might affect this process is the association of partially unfolded antiparallel structures.
    MeSH term(s) Circular Dichroism ; G-Quadruplexes ; Guanine/chemistry ; Humans ; Nucleic Acid Conformation ; Oligodeoxyribonucleotides/chemistry
    Chemical Substances Oligodeoxyribonucleotides ; Guanine (5Z93L87A1R)
    Language English
    Publishing date 2016-04
    Publishing country Netherlands
    Document type Journal Article ; Research Support, Non-U.S. Gov't
    ZDB-ID 185052-0
    ISSN 1873-4200 ; 0301-4622
    ISSN (online) 1873-4200
    ISSN 0301-4622
    DOI 10.1016/j.bpc.2016.02.002
    Database MEDical Literature Analysis and Retrieval System OnLINE

    Full text online

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 1147: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (1.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  4. Article ; Online: The role of loops and cation on the volume of unfolding of G-quadruplexes related to HTel.

    Li, Yang Yun / Dubins, David N / Le, Dianna My Nhi Thi / Leung, Karen / Macgregor, Robert B

    Biophysical chemistry

    2017  

    Abstract: In aqueous solutions containing sodium or potassium cations, oligodeoxyribonucleotides (ODNs) rich in guanine form four-stranded DNA structures called G-quadruplexes (G4s). These structures are destabilized by elevated hydrostatic pressure. Here, we use ... ...

    Abstract In aqueous solutions containing sodium or potassium cations, oligodeoxyribonucleotides (ODNs) rich in guanine form four-stranded DNA structures called G-quadruplexes (G4s). These structures are destabilized by elevated hydrostatic pressure. Here, we use pressure to investigate the volumetric changes arising from the formation of G4 structures. G4s display a great deal of structural heterogeneity that depends on the stabilizing cation as well as the oligonucleotide sequence. Using UV thermal unfolding at different pressures, we have investigated the volume change of the helix-coil equilibrium of a series of ODNs whose sequences are related to the G-rich ODN HTel (d[A(GGGTTA)
    Language English
    Publishing date 2017-01-06
    Publishing country Netherlands
    Document type Journal Article
    ZDB-ID 185052-0
    ISSN 1873-4200 ; 0301-4622
    ISSN (online) 1873-4200
    ISSN 0301-4622
    DOI 10.1016/j.bpc.2016.12.003
    Database MEDical Literature Analysis and Retrieval System OnLINE

    Full text online

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 1147: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (1.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

To top