LIVIVO - Search results -

Search results

Result 1 - 10 of total 17

Search options

Article ; Online: Mechanisms of Stem Cells and Their Secreted Exosomes in the Treatment of Autoimmune Diseases.

Lin, Shu-Qian / Wang, Kai / Pan, Xing-Hua / Ruan, Guang-Ping

2024

Abstract: Stem cells play a therapeutic role in many diseases by virtue of their strong self-renewal and differentiation abilities, especially in the treatment of autoimmune diseases. At present, the mechanism of the stem cell treatment of autoimmune diseases ... ...

Abstract	Stem cells play a therapeutic role in many diseases by virtue of their strong self-renewal and differentiation abilities, especially in the treatment of autoimmune diseases. At present, the mechanism of the stem cell treatment of autoimmune diseases mainly relies on their immune regulation ability, regulating the number and function of auxiliary cells, anti-inflammatory factors and proinflammatory factors in patients to reduce inflammation. On the other hand, the stem cell- derived secretory body has weak immunogenicity and low molecular weight, can target the site of injury, and can extend the length of its active time in the patient after combining it with the composite material. Therefore, the role of secretory bodies in the stem cell treatment of autoimmune diseases is increasingly important.
Language	English
Publishing date	2024-01-05
Publishing country	United Arab Emirates
Document type	Journal Article
ZDB-ID	2251937-3
ISSN	2212-3946 ; 1574-888X
ISSN (online)	2212-3946
ISSN	1574-888X
DOI	10.2174/011574888X271344231129053003
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 6399: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
ab Jg. 2022: Lesesaal (EG)

Order via subito

This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Cellular and molecular mechanisms of highly active mesenchymal stem cells in the treatment of senescence of rhesus monkey ovary.

Wang, Kai / Yao, Xiang / Lin, Shu-Qian / Zhu, Xiang-Qing / Pan, Xing-Hua / Ruan, Guang-Ping

Stem cell research & therapy

2024 Volume 15, Issue 1, Page(s) 14

Abstract: Background: Recent studies have shown that umbilical cord mesenchymal stem cells have an anti-aging effect in ovaries, but the cellular and molecular mechanisms of HA-MSC ovarian anti-aging remain to be studied. Therefore, we conducted a 10X Genomics ... ...

Abstract	Background: Recent studies have shown that umbilical cord mesenchymal stem cells have an anti-aging effect in ovaries, but the cellular and molecular mechanisms of HA-MSC ovarian anti-aging remain to be studied. Therefore, we conducted a 10X Genomics single-nucleus transcriptome sequencing experiment on the ovaries of macaque monkeys after HA-MSC treatment. Methods: The results of cell subgroup classification were visualized by 10X Genomics single nuclear transcriptome sequencing. The aging model of hGCs was established, and the migration ability of the cells was determined after coculture of HA-MSCs and aging hGCs. The genes screened by single nuclear transcriptional sequencing were verified in vitro by qPCR. Results: Compared with the aging model group, the number of cell receptor pairs in each subgroup of the HA-MSC-treated group increased overall. Treatment with 200 μmol/L H Conclusions: HA-MSC therapy can improve the tissue structure and secretion function of the ovary through multiple cellular and molecular mechanisms to resist ovarian aging. In vitro validation experiments further supported the results of single-cell sequencing, which provides evidence supporting a new option for stem cell treatment of ovarian senescence.
MeSH term(s)	Female ; Animals ; Macaca mulatta ; Ovary ; Hydrogen Peroxide ; Aging ; Mesenchymal Stem Cells
Chemical Substances	Hydrogen Peroxide (BBX060AN9V)
Language	English
Publishing date	2024-01-08
Publishing country	England
Document type	Journal Article
ZDB-ID	2548671-8
ISSN	1757-6512 ; 1757-6512
ISSN (online)	1757-6512
ISSN	1757-6512
DOI	10.1186/s13287-023-03631-x
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Article ; Online: Structural characterization and anti-oxidative activity for a glycopeptide from Ganoderma lucidum fruiting body.

Luo, Hong-Jian / Zhang, Yu-Kun / Wang, Sai-Zhen / Lin, Shu-Qian / Wang, Lian-Fu / Lin, Zhan-Xi / Lu, Guo-Dong / Lin, Dong-Mei

International journal of biological macromolecules

2024 Volume 261, Issue Pt 2, Page(s) 129793

Abstract: A water-soluble glycopeptide (named GL- ... ...

Abstract	A water-soluble glycopeptide (named GL-PWQ
MeSH term(s)	Reishi/chemistry ; Spectroscopy, Fourier Transform Infrared ; Polysaccharides/chemistry ; Glucose/analysis ; Molecular Weight ; Water
Chemical Substances	Polysaccharides ; Glucose (IY9XDZ35W2) ; Water (059QF0KO0R)
Language	English
Publishing date	2024-01-28
Publishing country	Netherlands
Document type	Journal Article
ZDB-ID	282732-3
ISSN	1879-0003 ; 0141-8130
ISSN (online)	1879-0003
ISSN	0141-8130
DOI	10.1016/j.ijbiomac.2024.129793
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.B 2374: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Increased Expression of Pluripotent Factors in Human Umbilical Cord Mesenchymal Stem Cells Transfected with Three tRF Molecules.

Ruan, Guang-Ping / Lin, Shu-Qian / Wang, Kai / Li, Zi-An / Pan, Xing-Hua

Molecular biotechnology

2022 Volume 65, Issue 7, Page(s) 1076–1084

Abstract: tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and ... ...

Abstract	tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.
MeSH term(s)	Humans ; RNA, Small Untranslated/metabolism ; Mesenchymal Stem Cells ; Umbilical Cord
Chemical Substances	RNA, Small Untranslated
Language	English
Publishing date	2022-11-27
Publishing country	Switzerland
Document type	Journal Article
ZDB-ID	1193057-3
ISSN	1559-0305 ; 1073-6085
ISSN (online)	1559-0305
ISSN	1073-6085
DOI	10.1007/s12033-022-00596-9
Database	MEDical Literature Analysis and Retrieval System OnLINE

Full text online

Accessible to users with ZB MED library card

In stock of ZB MED Cologne/Königswinter

Zs.A 4031: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (2.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾

Article ; Online: Ganoderic acids alleviate atherosclerosis by inhibiting macrophage M1 polarization via TLR4/MyD88/NF-κB signaling pathway.

Quan, Ya-Zhu / Ma, Ang / Ren, Chao-Qun / An, Yong-Pan / Qiao, Pan-Shuang / Gao, Cai / Zhang, Yu-Kun / Li, Xiao-Wei / Lin, Si-Mei / Li, Nan-Nan / Chen, Di-Long / Pan, Yan / Zhou, Hong / Lin, Dong-Mei / Lin, Shu-Qian / Li, Min / Yang, Bao-Xue

Atherosclerosis

2024 Volume 391, Page(s) 117478

Abstract: Background and aims: Atherosclerosis (AS) is a chronic inflammatory disease characterized by lipid infiltration and plaque formation in blood vessel walls. Ganoderic acids (GA), a class of major bioactive compounds isolated from the Chinese traditional ... ...

Abstract	Background and aims: Atherosclerosis (AS) is a chronic inflammatory disease characterized by lipid infiltration and plaque formation in blood vessel walls. Ganoderic acids (GA), a class of major bioactive compounds isolated from the Chinese traditional medicine Ganoderma lucidum, have multiple pharmacological activities. This study aimed to determine the anti-atherosclerotic effect of GA and reveal the pharmacological mechanism. Methods: ApoE Results: It was found that GA at 5 and 25 mg/kg/d significantly inhibited the development of AS and increased plaque stability, as evidenced by decreased plaque in the aorta, reduced necrotic core size and increased collagen/lipid ratio in lesions. GA reduced the proportion of M1 macrophages in plaques, but had no effect on M2 macrophages. In vitro experiments showed that GA (1, 5, 25 μg/mL) significantly decreased the proportion of CD86 Conclusions: This study demonstrated that GA play an important role in plaque stability and macrophage polarization. GA exert the anti-atherosclerotic effect partly by regulating TLR4/MyD88/NF-κB signaling pathways to inhibit M1 polarization of macrophages. Our study provides theoretical basis and experimental data for the pharmacological activity and mechanisms of GA against AS.
MeSH term(s)	Mice ; Animals ; NF-kappa B/metabolism ; Myeloid Differentiation Factor 88/metabolism ; Myeloid Differentiation Factor 88/pharmacology ; Toll-Like Receptor 4/metabolism ; Atherosclerosis/drug therapy ; Atherosclerosis/prevention & control ; Atherosclerosis/genetics ; Plaque, Atherosclerotic/metabolism ; Signal Transduction ; Macrophages/metabolism ; Lipids
Chemical Substances	NF-kappa B ; Myeloid Differentiation Factor 88 ; Toll-Like Receptor 4 ; Lipids
Language	English
Publishing date	2024-02-08
Publishing country	Ireland
Document type	Journal Article
ZDB-ID	80061-2
ISSN	1879-1484 ; 0021-9150
ISSN (online)	1879-1484
ISSN	0021-9150
DOI	10.1016/j.atherosclerosis.2024.117478
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 226: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (1.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Interplay between autophagy and apoptosis in lead(II)-induced cytotoxicity of primary rat proximal tubular cells.

Chu, Bing-Xin / Fan, Rui-Feng / Lin, Shu-Qian / Yang, Du-Bao / Wang, Zhen-Yong / Wang, Lin

Journal of inorganic biochemistry

2018 Volume 182, Page(s) 184–193

Abstract: Autophagy and apoptosis are two different biological processes that determine cell fates. We previously reported that autophagy inhibition and apoptosis induction are involved in lead(II)-induced cytotoxicity in primary rat proximal tubular (rPT) cells, ... ...

Abstract	Autophagy and apoptosis are two different biological processes that determine cell fates. We previously reported that autophagy inhibition and apoptosis induction are involved in lead(II)-induced cytotoxicity in primary rat proximal tubular (rPT) cells, but the interplay between them remains to be elucidated. Firstly, data showed that lead(II)-induced elevation of LC3-II protein levels can be significantly modulated by 3-methyladenine or rapamycin; moreover, protein levels of Autophagy-related protein 5 (Atg5) and Beclin-1 were markedly up-regulated by lead(II) treatment, demonstrating that lead(II) could promote the autophagosomes formation in rPT cells. Next, we applied three pharmacological agents and genetic method targeting the early stage of autophagy to validate that enhancement of autophagosomes formation can inhibit lead(II)-induced apoptotic cell death in rPT cells. Simultaneously, lead(II) inhibited the autophagic degradation of rPT cells, while the addition of autophagic degradation inhibitor bafilomycin A1 aggravated lead(II)-induced apoptotic death in rPT cells. Collectively, this study provided us a good model to know about the dynamic process of lead(II)-induced autophagy in rPT cells, and the interplay between autophagy and apoptosis highlights a new sight into the mechanism of lead(II)-induced nephrotoxicity.
MeSH term(s)	Adenine/analogs & derivatives ; Adenine/pharmacology ; Animals ; Apoptosis/drug effects ; Autophagy/drug effects ; Autophagy-Related Protein 5/metabolism ; Beclin-1/metabolism ; Cells, Cultured ; Kidney Tubules, Proximal/cytology ; Lead/toxicity ; Microtubule-Associated Proteins/metabolism ; Rats ; Sirolimus/pharmacology
Chemical Substances	Autophagy-Related Protein 5 ; Beclin-1 ; LC3 protein, rat ; Microtubule-Associated Proteins ; Lead (2P299V784P) ; 3-methyladenine (5142-23-4) ; Adenine (JAC85A2161) ; Sirolimus (W36ZG6FT64)
Language	English
Publishing date	2018-02-24
Publishing country	United States
Document type	Journal Article ; Research Support, Non-U.S. Gov't
ZDB-ID	162843-4
ISSN	1873-3344 ; 0162-0134
ISSN (online)	1873-3344
ISSN	0162-0134
DOI	10.1016/j.jinorgbio.2018.02.015
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.B 1730: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Ganoderic acid A is the effective ingredient of Ganoderma triterpenes in retarding renal cyst development in polycystic kidney disease.

Meng, Jia / Sai-Zhen Wang / He, Jin-Zhao / Zhu, Shuai / Huang, Bo-Yue / Wang, Shu-Yuan / Li, Min / Zhou, Hong / Lin, Shu-Qian / Yang, Bao-Xue

Acta pharmacologica Sinica

2020 Volume 41, Issue 6, Page(s) 782–790

Abstract: Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common life-threatening monogenetic diseases characterized by progressive enlargement of fluid-filled renal cysts. Our previous study has shown that Ganoderma triterpenes (GT) ... ...

Abstract	Autosomal dominant polycystic kidney disease (ADPKD) is one of the most common life-threatening monogenetic diseases characterized by progressive enlargement of fluid-filled renal cysts. Our previous study has shown that Ganoderma triterpenes (GT) retards PKD renal cyst development. In the present study we identified the effective ingredient of GT in suppression of kidney cyst development. Using an in vitro MDCK cystogenesis model, we identified ganoderic acid A (GA-A) as the most promising candidate among the 12 ganoderic acid (GA) monomers. We further showed that GA-A (6.25-100 μM) significantly inhibited cyst growth in MDCK cyst model and embryonic kidney cyst model in vitro, and the inhibitory effect was reversible. In kidney-specific Pkd1 knockout (kPKD) mice displaying severe cystic kidney disease, administration of GA-A (50 mg· kg
MeSH term(s)	Animals ; Cell Proliferation/drug effects ; Cells, Cultured ; Disease Models, Animal ; Dogs ; Dose-Response Relationship, Drug ; Ganoderma/chemistry ; Heptanoic Acids/administration & dosage ; Heptanoic Acids/isolation & purification ; Heptanoic Acids/pharmacology ; Injections, Subcutaneous ; Lanosterol/administration & dosage ; Lanosterol/analogs & derivatives ; Lanosterol/isolation & purification ; Lanosterol/pharmacology ; Madin Darby Canine Kidney Cells/drug effects ; Mice ; Mice, Inbred C57BL ; Mice, Inbred ICR ; Polycystic Kidney Diseases/drug therapy ; Polycystic Kidney Diseases/pathology
Chemical Substances	Heptanoic Acids ; Lanosterol (1J05Z83K3M) ; ganoderic acid A (548G37DF65)
Keywords	covid19
Language	English
Publishing date	2020-01-07
Publishing country	United States
Document type	Journal Article
ZDB-ID	1360774-1
ISSN	1745-7254 ; 0253-9756 ; 1671-4083
ISSN (online)	1745-7254
ISSN	0253-9756 ; 1671-4083
DOI	10.1038/s41401-019-0329-2
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 1904: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (1.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Ganoderic acid hinders renal fibrosis via suppressing the TGF-β/Smad and MAPK signaling pathways.

Geng, Xiao-Qiang / Ma, Ang / He, Jin-Zhao / Wang, Liang / Jia, Ying-Li / Shao, Guang-Ying / Li, Min / Zhou, Hong / Lin, Shu-Qian / Ran, Jian-Hua / Yang, Bao-Xue

Acta pharmacologica Sinica

2019 Volume 41, Issue 5, Page(s) 670–677

Abstract: Renal fibrosis is considered as the pathway of almost all kinds of chronic kidney diseases (CKD) to the end stage of renal diseases (ESRD). Ganoderic acid (GA) is a group of lanostane triterpenes isolated from Ganoderma lucidum, which has shown a variety ...

Abstract	Renal fibrosis is considered as the pathway of almost all kinds of chronic kidney diseases (CKD) to the end stage of renal diseases (ESRD). Ganoderic acid (GA) is a group of lanostane triterpenes isolated from Ganoderma lucidum, which has shown a variety of pharmacological activities. In this study we investigated whether GA exerted antirenal fibrosis effect in a unilateral ureteral obstruction (UUO) mouse model. After UUO surgery, the mice were treated with GA (3.125, 12.5, and 50 mg· kg
MeSH term(s)	Animals ; Cells, Cultured ; Disease Models, Animal ; Dose-Response Relationship, Drug ; Humans ; Injections, Intraperitoneal ; MAP Kinase Signaling System/drug effects ; Male ; Mice ; Mice, Inbred C57BL ; Signal Transduction/drug effects ; Smad Proteins/antagonists & inhibitors ; Smad Proteins/metabolism ; Transforming Growth Factor beta/antagonists & inhibitors ; Transforming Growth Factor beta/metabolism ; Triterpenes/administration & dosage ; Triterpenes/pharmacology ; Ureteral Obstruction/drug therapy ; Ureteral Obstruction/metabolism ; Ureteral Obstruction/surgery
Chemical Substances	Smad Proteins ; Transforming Growth Factor beta ; Triterpenes ; ganoderic acid
Keywords	covid19
Language	English
Publishing date	2019-12-05
Publishing country	United States
Document type	Journal Article
ZDB-ID	1360774-1
ISSN	1745-7254 ; 0253-9756 ; 1671-4083
ISSN (online)	1745-7254
ISSN	0253-9756 ; 1671-4083
DOI	10.1038/s41401-019-0324-7
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 1904: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (1.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article: Protective effects of quercetin on cadmium-induced cytotoxicity in primary cultures of rat proximal tubular cells.

Wang, Lin / Lin, Shu Qian / He, Yuan Long / Liu, Gang / Wang, Zhen Yong

Biomedical and environmental sciences : BES

2013 Volume 26, Issue 4, Page(s) 258–267

Abstract: Objective: To investigate the protective effects of quercetin on cadmium-induced cytotoxicity in primary cultures of rat proximal tubular (rPT) cells.: Methods: Primary cultures of rPT cells undergoing exponential growth were incubated with 1.0 μg/mL ...

Abstract	Objective: To investigate the protective effects of quercetin on cadmium-induced cytotoxicity in primary cultures of rat proximal tubular (rPT) cells. Methods: Primary cultures of rPT cells undergoing exponential growth were incubated with 1.0 μg/mL quercetin and/or cadmium (2.5, 5.0 μmol/L), in a serum-free medium at 37 °C at different time intervals. Commercial kits were used and flow cytometric analyses were performed on rPT cell cultures to assay apoptosis and oxidative stress. Results: Exposure of rPT cells to cadmium acetate (2.5, 5.0 µmol/L) induced a decrease in cell viability, caused an increase in apoptotic rate and apoptotic morphological changes. Simultaneously, elevation of intracellular reactive oxygen species, malondialdehyde and calcium levels, depletion of mitochondrial membrane potential and intracellular glutathione, and inhibition of Na+, K+-ATPase, Ca2+-ATPase, glutathione peroxidase (GSH-Px), catalase (CAT), and superoxide dismutase (SOD) activities were revealed during the cadmium exposure of rPT cells. However, simultaneous supplementation with 1 µg/mL quercetin protected rPT cells against cadmium-induced cytotoxicity through inhibiting apoptosis, attenuating lipid peroxidation, renewing mitochondrial function and elevating the intracellular antioxidants (non-enzymatic and enzymic) levels. Conclusion: The present study has suggested that quercetin, as a widely distributed dietary antioxidant, contributes potentially to prevent cadmium-induced cytotoxicity in rPT cells.
MeSH term(s)	Animals ; Antioxidants/pharmacology ; Antioxidants/therapeutic use ; Apoptosis/drug effects ; Cadmium/toxicity ; Cadmium Poisoning/prevention & control ; Calcium/metabolism ; Calcium-Transporting ATPases/metabolism ; Cells, Cultured ; Kidney Tubules, Proximal/drug effects ; Kidney Tubules, Proximal/metabolism ; Malondialdehyde/metabolism ; Membrane Potential, Mitochondrial/drug effects ; Quercetin/pharmacology ; Quercetin/therapeutic use ; Rats ; Reactive Oxygen Species/metabolism ; Sodium-Potassium-Exchanging ATPase/metabolism
Chemical Substances	Antioxidants ; Reactive Oxygen Species ; Cadmium (00BH33GNGH) ; Malondialdehyde (4Y8F71G49Q) ; Quercetin (9IKM0I5T1E) ; Calcium-Transporting ATPases (EC 3.6.3.8) ; Sodium-Potassium-Exchanging ATPase (EC 3.6.3.9) ; Calcium (SY7Q814VUP)
Language	English
Publishing date	2013-04
Publishing country	Netherlands
Document type	Journal Article ; Research Support, Non-U.S. Gov't
ZDB-ID	645083-0
ISSN	0895-3988
ISSN	0895-3988
DOI	10.3967/0895-3988.2013.04.004
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 2459: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (2.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article: [Effect of Ganoderma lucidum polysaccharides peptide on invasion of human lung carcinoma cells in vitro].

Cao, Qi Zhen / Lin, Shu Qian / Wang, Sai Zhen

Beijing da xue xue bao. Yi xue ban = Journal of Peking University. Health sciences

2007 Volume 39, Issue 6, Page(s) 653–656

Abstract: Objective: To find out the effects of Ganoderma lucidum polysaccharides peptide (Gl-PP) on the invasion of the human lung carcinoma cell (PG cell).: Methods: PG cells were pretreated with different concentration Gl-PP in vitro, using cell ... ...

Abstract	Objective: To find out the effects of Ganoderma lucidum polysaccharides peptide (Gl-PP) on the invasion of the human lung carcinoma cell (PG cell). Methods: PG cells were pretreated with different concentration Gl-PP in vitro, using cell proliferation assay, cell migration assay, adhesion assay, zymography and RT-PCR, then the effects of Gl-PP on proliferation, motility, adhesion and MMP-9 activity and mRNA expression of PG cells were investigated in vitro. Results: Gl-PP did not directly inhibit PG cell proliferation in vitro. However, pretreated with Gl-PP, PG cells motility was inhibited significantly. PG cells adhesion was also inhibited. The activity of MMP-9 was inhibited in a dose-dependent manner, and the inhibited ratio was 41.53% at a dose of 100 mg/L Gl-PP. The mRNA expression of MMP-9 of pretreated PG cells was inhibited. Conclusion: Gl-PP could suppress invasion of human lung carcinoma cells in vitro.
MeSH term(s)	Cell Adhesion/drug effects ; Cell Line, Tumor ; Cell Movement/drug effects ; Cell Proliferation/drug effects ; Humans ; Lung Neoplasms/metabolism ; Lung Neoplasms/pathology ; Matrix Metalloproteinase 9/metabolism ; Neoplasm Invasiveness ; Proteoglycans/pharmacology ; Reishi
Chemical Substances	Proteoglycans ; polysaccharide peptide ; MMP9 protein, human (EC 3.4.24.35) ; Matrix Metalloproteinase 9 (EC 3.4.24.35)
Language	Chinese
Publishing date	2007-12-18
Publishing country	China
Document type	English Abstract ; Journal Article
ISSN	1671-167X
ISSN	1671-167X
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

To top

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

Full text online

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

Order via subito

Inter-library loan at ZB MED