LIVIVO - Search results -

Search results

Result 1 - 10 of total 119

Search options

Article ; Online: Prediction of Clinical Response to Dupilumab in Patients with Severe Asthma Using Fractional Exhaled Nitric Oxide Combined with Pulmonary Function Testing.

Liu, Yi-Liang / Zhang, Yong

International archives of allergy and immunology

2024 , Page(s) 1–9

Abstract: Introduction: This study aimed to assess the effectiveness of fractional exhaled nitric oxide (FeNO) combined with pulmonary function testing (PFT) for predicting the treatment outcome of patients with severe asthma receiving dupilumab.: Methods: A ... ...

Abstract	Introduction: This study aimed to assess the effectiveness of fractional exhaled nitric oxide (FeNO) combined with pulmonary function testing (PFT) for predicting the treatment outcome of patients with severe asthma receiving dupilumab. Methods: A total of 31 patients with severe asthma visiting our hospital from January 2022 to June 2023 were included in this study, with 28 patients completing a 16-week course of dupilumab treatment. Baseline clinical data, including demographic information, blood eosinophil counts, serum IgE levels, FeNO, asthma control test (ACT), asthma control questionnaire (ACQ), and other parameters, were collected. A predictive model using a generalized linear model was established. Results: Following the 16-week course of dupilumab treatment, 22 patients showed effective response based on GETE scores, while 6 patients were nonresponders. Notably, significant improvements were observed in clinical parameters such as blood eosinophil counts, serum IgE levels, FeNO, FEV1, FEV1%, ACT, and ACQ in both response groups (p < 0.05). FeNO and pulmonary function tests demonstrated AUC values of 0.530, 0.561, and 0.765, respectively, in predicting the clinical efficacy of dupilumab, which were lower than when FeNO was combined with FEV1%. The combination of FeNO and FEV1% had a sensitivity of 1.000 and specificity of 0.591 in predicting treatment response. Conclusion: The combined assessment of FeNO and FEV1% provides improved accuracy for predicting the clinical efficacy of dupilumab in managing severe asthma. However, further larger scale clinical studies with comprehensive follow-up data are needed to validate the therapeutic efficacy and applicability across diverse patient populations.
Language	English
Publishing date	2024-04-30
Publishing country	Switzerland
Document type	Journal Article
ZDB-ID	1108932-5
ISSN	1423-0097 ; 1018-2438
ISSN (online)	1423-0097
ISSN	1018-2438
DOI	10.1159/000538542
Database	MEDical Literature Analysis and Retrieval System OnLINE

Full text online

Accessible to users with ZB MED library card

In stock of ZB MED Cologne/Königswinter

Uh III Zs.155: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
ab Jg. 2022: Lesesaal (EG)

Order via subito

This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

Details ▾

Article ; Online: Artificial intelligence for caries detection: a novel diagnostic tool using deep learning algorithms.

Liu, Yiliang / Xia, Kai / Cen, Yueyan / Ying, Sancong / Zhao, Zhihe

Oral radiology

2024

Abstract: Objectives: The aim of this study was to develop an assessment tool for automatic detection of dental caries in periapical radiographs using convolutional neural network (CNN) architecture.: Methods: A novel diagnostic model named ResNet + SAM was ... ...

Abstract	Objectives: The aim of this study was to develop an assessment tool for automatic detection of dental caries in periapical radiographs using convolutional neural network (CNN) architecture. Methods: A novel diagnostic model named ResNet + SAM was established using numerous periapical radiographs (4278 images) annotated by medical experts to automatically detect dental caries. The performance of the model was compared to the traditional CNNs (VGG19, ResNet-50), and the dentists. The Gradient-weighted Class Activation Mapping (Grad-CAM) technique shows the region of interest in the image for the CNNs. Results: ResNet + SAM demonstrated significantly improved performance compared to the modified ResNet-50 model, with an average F1 score of 0.886 (95% CI 0.855-0.918), accuracy of 0.885 (95% CI 0.862-0.901) and AUC of 0.954 (95% CI 0.924-0.980). The comparison between the performance of the model and the dentists revealed that the model achieved higher accuracy than that of the junior dentists. With the assist of the tool, the dentists achieved superior metrics with a mean F1 score of 0.827 and the interobserver agreement for dental caries is enhanced from 0.592/0.610 to 0.706/0.723. Conclusions: According to the results obtained from the experiments, the automatic assessment tool using the ResNet + SAM model shows remarkable performance and has excellent possibilities in identifying dental caries. The use of the assessment tool in clinical practice can be of great benefit as a clinical decision-making support in dentistry and reduce the workload of dentists.
Language	English
Publishing date	2024-03-18
Publishing country	Japan
Document type	Journal Article
ZDB-ID	639456-5
ISSN	1613-9674 ; 0911-6028
ISSN (online)	1613-9674
ISSN	0911-6028
DOI	10.1007/s11282-024-00741-x
Database	MEDical Literature Analysis and Retrieval System OnLINE

Full text online

Accessible to users with ZB MED library card

In stock of ZB MED Cologne/Königswinter

Zs.B 3256: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾

Article ; Online: Isoflavones isolated from the fruits of Ficus altissima and their anti-proliferative activities.

Liu, Yiliang / Pu, Yajing / Shen, Liyuan / Li, Dan / Xu, Jingwen / He, Xiangjiu / Wang, Yihai

Fitoterapia

2024 Volume 175, Page(s) 105966

Abstract: Ficus altissima, also known as lofty fig, is a monoecious plant from the Moraceae family commonly found in southern China. In this study, we isolated and identified one new isoflavone (1), three new hydroxycoumaronochromones (2a, 2b and 3a) and 12 known ... ...

Abstract	Ficus altissima, also known as lofty fig, is a monoecious plant from the Moraceae family commonly found in southern China. In this study, we isolated and identified one new isoflavone (1), three new hydroxycoumaronochromones (2a, 2b and 3a) and 12 known compounds from the fruits of F. altissima. Their chemical structures were determined using spectroscopic analysis methods. We also tested all the isolated compounds for their anti-proliferative activities against eight human tumour cell lines (A-549, AGS, K562, K562/ADR, HepG2, HeLa, SPC-A-1 and CNE2) using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay. Our experiments showed that compound 6 exhibited obvious anti-proliferative activity against the K562 cell line with an IC
Language	English
Publishing date	2024-04-16
Publishing country	Netherlands
Document type	Journal Article
ZDB-ID	412385-2
ISSN	1873-6971 ; 0367-326X
ISSN (online)	1873-6971
ISSN	0367-326X
DOI	10.1016/j.fitote.2024.105966
Database	MEDical Literature Analysis and Retrieval System OnLINE

Full text online

Accessible to users with ZB MED library card

In stock of ZB MED Cologne/Königswinter

Zs.B 1873: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾

Article ; Online: [Advances in Immunotherapy for Malignant Pleural Mesothelioma].

Chi, Yujia / Liu, Yiliang / Zhao, Jun

Zhongguo fei ai za zhi = Chinese journal of lung cancer

2022 Volume 25, Issue 4, Page(s) 259–265

Abstract: Patients with malignant pleural mesothelioma (MPM) usually present with poor prognosis and short survival period, and there has been a lack of effective treatment options for a long time. Chemotherapy has limited improvement in the clinical outcome of ... ...

Abstract	Patients with malignant pleural mesothelioma (MPM) usually present with poor prognosis and short survival period, and there has been a lack of effective treatment options for a long time. Chemotherapy has limited improvement in the clinical outcome of advanced patients (the median survival is less than one year), and it is difficult to find suitable targets for targeted therapy. Recent in-depth research on immunotherapy has changed the treatment pattern of MPM. Especially, the dual immunotherapy regimen significantly improved the survival outcome of patients across subgroups and prolonged the survival time of MPM patients. Therefore, it has been approved for unresectable MPM as first-line treatment for patients. The exploration of other mono or combo immunotherapy regimens in the first and second-line settings of MPM is also underway. How to identify the best beneficial population of each regimen through predictive biomarkers is also a hot spot for researchers. This article will focus on the most up-to-date progress of MPM epidemiology, histological characteristics, pathogenesis, treatment patterns and the advances of immunotherapy in the disease. .
MeSH term(s)	Combined Modality Therapy ; Humans ; Immunotherapy ; Lung Neoplasms/drug therapy ; Mesothelioma/drug therapy ; Mesothelioma, Malignant ; Pleural Neoplasms/drug therapy
Language	Chinese
Publishing date	2022-04-27
Publishing country	China
Document type	Journal Article
ZDB-ID	2438672-8
ISSN	1999-6187 ; 1009-3419
ISSN (online)	1999-6187
ISSN	1009-3419
DOI	10.3779/j.issn.1009-3419.2022.101.17
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Article ; Online: First Report of Arthrobacter woluwensis Causing Brown Blotch Disease on White Button Mushroom (Agaricus bisporus)

Huang, Zaixing / Huang, Haisi / Ding, Chengpei / Liu, Yiliang / Liu, Yinyin / Liu, Bin

Plant Disease. 2023 Sept. 01, v. 107, no. 9 p.2840-

2023

Abstract: Agaricus bisporus is one of the most commonly grown edible fungi in the world. In December 2021, brown blotch disease (2% incidence) was observed on the cap of A. bisporus, growing in a mushroom cultivation base in Guangxi, China. Initially, brown ... ...

Abstract	Agaricus bisporus is one of the most commonly grown edible fungi in the world. In December 2021, brown blotch disease (2% incidence) was observed on the cap of A. bisporus, growing in a mushroom cultivation base in Guangxi, China. Initially, brown blotches (1 to 1.3 cm) appeared on the cap of A. bisporus, which expanded gradually as the cap grew. After 2 days, the infection penetrated inner tissues of fruiting bodies, and blotches were dark brown. For the isolation of causative agent(s), internal tissue samples of the infected stipes (5 × 5 × 5 mm) were sterilized in 75% ethanol for 30 s, rinsed three times with sterile deionized water (SDW), and then mashed in the sterile 2-ml Eppendorf tubes; 1,000 μl of SDW was added; and the suspension was diluted into seven concentrations (10⁻¹ to 10⁻⁷). Each suspension (120 μl) was spread on Luria Bertani (LB) medium and incubated for 24 h at 28°C. Morphological examination of the isolates was referred to Liu et al. (2022). The dominant single colonies were whitish gray, smooth, and convex. The cells were gram-positive, nonflagellated, and nonmotile; no pods or endospores were formed; and no fluorescent pigments were produced on King’s B medium (Solarbio). 16S rRNA sequences (1,351 bp; OP740790) of five colonies were amplified using the universal primer 27f/1492r (Liu et al. 2022), and they exhibited 99.26% identity with Arthrobacter (Ar.) woluwensis. The partial sequences of the ATP synthase subunit beta gene (atpD; 677 bp; OQ262957), RNA polymerase subunit beta gene (rpoB; 848 bp; OQ262958), preprotein translocase subunit SecY gene (secY; 859 bp; OQ262959), and elongation factor Tu gene (tuf; 831 bp; OQ262960) of colonies were amplified using the method of Liu et al. (2018), and they also exhibited more than 99% similarity to Ar. woluwensis. The biochemical tests for isolates (n = 3) were performed through bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent), and the results showed biochemical characteristics similar to those of Ar. woluwensis (positive for esculin hydrolysis, urea, gelatinase, catalase, sorbitol, gluconate, salicin, and arginine, and negative for citrate, nitrate reduction, and rhamnose; Funke et al. 1996). The isolates were identified as Ar. woluwensis based on morphological characteristics, biochemical tests, and phylogenetic analysis. Pathogenicity tests were performed with bacterial suspensions (1 × 10⁹ CFU/ml) after growing for 36 h in LB broth at 28°C and 160 rpm. Thirty microliters of bacterial suspension was added to the cap and tissue of young A. bisporus. SDW was added as a negative control. All treatments were incubated at 20°C and 80 to 85% relative humidity. The experiment was repeated three times with five caps and five tissues of young A. bisporus each time. Brown blotches were observed on all the parts of the inoculated caps and tissues after 24 h of inoculation. At 48 h, the inoculated caps turned dark brown, while the infected tissues changed from brown to black and expanded to the entire tissue block, giving a severely rotten appearance and foul odor. These disease symptoms were similar to those observed in the original samples. There were no lesions in the control group. After the pathogenicity test, the pathogen was reisolated from the infected caps and tissues based on morphological characteristics, 16S rRNA sequences, and biochemical results, fulfilling Koch’s postulates. Arthrobacter spp. are very widely distributed in the environment (Kim et al. 2008). To date, two studies have confirmed Arthrobacter spp. as a pathogen of edible fungi (Bessette 1984; Wang et al. 2019). However, this is the first report of Ar. woluwensis causing brown blotch disease on A. bisporus. Our finding could contribute to developing phytosanitary and control treatments for this disease.
Keywords	Agaricus bisporus ; Arthrobacter woluwensis ; DNA-directed RNA polymerase ; H-transporting ATP synthase ; arginine ; catalase ; citrates ; endospores ; esculin ; ethanol ; fluorescence ; genes ; gluconates ; hydrolysis ; mushroom growing ; nitrate reduction ; off odors ; pathogenicity ; pathogens ; peptide elongation factors ; phylogeny ; relative humidity ; rhamnose ; sorbitol ; urea ; China ; bacterial blotch disease
Language	English
Dates of publication	2023-0901
Publishing place	The American Phytopathological Society
Document type	Article ; Online
ZDB-ID	754182-x
ISSN	0191-2917
ISSN	0191-2917
DOI	10.1094/PDIS-11-22-2711-PDN
Database	NAL-Catalogue (AGRICOLA)

In stock of ZB MED Bonn / Germany

Z 2043: Show issues

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

Book ; Online: Deep Learning Based Joint Beamforming Design in IRS-Assisted Secure Communications

Zhang, Chi / Liu, Yiliang / Chen, Hsiao-Hwa

2023

Abstract: In this article, physical layer security (PLS) in an intelligent reflecting surface (IRS) assisted multiple-input multiple-output multiple antenna eavesdropper (MIMOME) system is studied. In particular, we consider a practical scenario without ... ...

Abstract	In this article, physical layer security (PLS) in an intelligent reflecting surface (IRS) assisted multiple-input multiple-output multiple antenna eavesdropper (MIMOME) system is studied. In particular, we consider a practical scenario without instantaneous channel state information (CSI) of the eavesdropper and assume that the eavesdropping channel is a Rayleigh channel. To reduce the complexity of currently available IRS-assisted PLS schemes, we propose a low-complexity deep learning (DL) based approach to design transmitter beamforming and IRS jointly, where the precoding vector and phase shift matrix are designed to minimize the secrecy outage probability. Simulation results demonstrate that the proposed DL-based approach can achieve a similar performance of that with conventional alternating optimization (AO) algorithms for a significant reduction in the computational complexity.
Keywords	Computer Science - Information Theory ; Electrical Engineering and Systems Science - Signal Processing
Subject code	003
Publishing date	2023-04-04
Publishing country	us
Document type	Book ; Online
Database	BASE - Bielefeld Academic Search Engine (life sciences selection)

Full text online

Full text

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Article ; Online: First Report of Pseudomonas mosselii Causing White Blotch Disease in Pleurotus pulmonarius in China

Huang, Zaixing / Wei, Zhiyuan / Chen, Han / Liu, Yinyin / Liu, Yiliang / Liu, Bin

Plant Disease. 2023 Feb. 01, v. 107, no. 2 p.549-

2023

Abstract: Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7 ... ...

Abstract	Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7 to 1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen was isolated from infected cap tissues using a dilution plate technique: sections of tissue (∼5 × 5 × 5 mm) with white blotch were rinsed three times in sterile deionized water (SDW) and mashed in sterile 2-ml Eppendorf tubes, 1,000 µl of sterile water was added, and the suspension was diluted into eight concentrations (10⁻¹ to 10⁻⁸). From each concentration, 120 µl of suspension was spread on Luria Bertani (LB) medium and incubated for 24 h at 28°C. Both 10⁻⁵ and 10⁻⁶ suspensions had single colonies; the dominant single colonies were picked and purified two to three times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth, and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King’s B medium. Amplified 16S rDNA (1,396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r exhibited 100% identity to Pseudomonas (Ps.) mosselii. Partial sequences of the rpoB (1,173 bp; OM202622), rpoD (734 bp; ON469579), gyrB (1,383 bp; OM202621), and recA (887 bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27 (Tayeb et al. 2005), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018), and recA-F (5′–3′ ACGACAACAAGAAGCGCGCCTT)/recA-R (5′–3′ CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, and exhibited 99 to 100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates clustered with Ps. mosselii. Biochemical tests for isolates were performed via bacterial microbiochemical reaction tubes (Hangzhou Microbial Reagent Co.), and results showed the same biochemical characteristics as Ps. mosselii (positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine, and gelatin; negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction, and malonate) (Dabboussi et al. 2002; Soto-Rodriguez et al. 2013). Isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. The isolate was incubated in LB broth at 28°C and 160 rpm for 24 h, and bacterial cells were collected by centrifugation at 4,000 rpm for 10 min. The collected cells were resuspended in SDW. For pathogenicity tests, 30 µl of bacterial suspension (∼1 × 10⁹ CFU/ml) was added to the surface of the cap (3 to 4 cm) of young P. pulmonarius. SDW was added as a negative control. All treatments were incubated at 22°C and 80 to 85% humidity. The experiment was repeated three times with three bags each time. Twelve hours later, white blotches were visible on all parts of the inoculated mushroom. Disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initial isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB, and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It was shown to be pathogenic to Oreochromis niloticus and humans (Huang et al. 2018; Leneveu-Jenvrin et al. 2013; Peña et al. 2019; Soto-Rodriguez et al. 2013). This is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects its commercial value and requires attention of the mushroom industry.
Keywords	Oreochromis niloticus ; Pleurotus pulmonarius ; Pseudomonas mosselii ; arabinose ; arginine ; arginine deiminase ; bacteria ; centrifugation ; citrates ; endospores ; farms ; flagellum ; fluorescence ; galactose ; gelatin ; glucosamine ; humidity ; industry ; inositols ; lactose ; lysine ; maltose ; mannose ; mushrooms ; nitrate reduction ; ornithine ; pathogenicity ; pathogens ; phylogeny ; rhamnose ; sucrose ; urea ; xylose ; China ; bacterial diseases
Language	English
Dates of publication	2023-0201
Publishing place	The American Phytopathological Society
Document type	Article ; Online
ZDB-ID	754182-x
ISSN	0191-2917
ISSN	0191-2917
DOI	10.1094/PDIS-01-22-0201-PDN
Database	NAL-Catalogue (AGRICOLA)

In stock of ZB MED Bonn / Germany

Z 2043: Show issues

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Epoxy-Acrylic Polymer In-Situ Filling Cell Lumen and Bonding Cell Wall for Wood Reinforcement and Stabilization.

Liu, Yiliang / Fan, Jilong / Yao, Fengbiao / Gao, Xudong / Zhao, Yueying / Liu, Baoxuan / Dong, Xiaoying / Li, Yongfeng

Polymers

2024 Volume 16, Issue 1

Abstract: Under a global carbon-neutralizing environment, renewable wood is a viable alternative to non-renewable resources due to its abundance and high specific strength. However, fast-growing wood is hard to be applied extensively due to low mechanical strength ...

Abstract	Under a global carbon-neutralizing environment, renewable wood is a viable alternative to non-renewable resources due to its abundance and high specific strength. However, fast-growing wood is hard to be applied extensively due to low mechanical strength and poor dimensional stability and durability. In this study, epoxy-acrylic resin-modified wood was prepared by forming a functional monomer system with three monomers [glycidyl methacrylate (GMA), maleic anhydride (MAN), and polyethylene glycol-200-dimethylacrylic acid (PEGDMA)] and filling into the wood cell cavity. The results showed that in the case of an optimal monomer system of nGMA:nPEGDMA = 20:1 and an optimal MAN dosage of 6%, the conversion rate of monomers reached 98.01%, the cell cavity was evenly filled by the polymer, with the cell wall chemically bonded. Thus, a bonding strength of as high as 1.13 MPa, a bending strength of 112.6 MPa and an impact toughness of 74.85 KJ/m
Language	English
Publishing date	2024-01-03
Publishing country	Switzerland
Document type	Journal Article
ZDB-ID	2527146-5
ISSN	2073-4360 ; 2073-4360
ISSN (online)	2073-4360
ISSN	2073-4360
DOI	10.3390/polym16010152
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Article: Research Progress on Controlled Low-Strength Materials: Metallurgical Waste Slag as Cementitious Materials.

Liu, Yiliang / Su, Youpo / Xu, Guoqiang / Chen, Yanhua / You, Gaoshuai

Materials (Basel, Switzerland)

2022 Volume 15, Issue 3

Abstract: Increasing global cement and steel consumption means that a significant amount of greenhouse gases and metallurgical wastes are discharged every year. Using metallurgical waste as supplementary cementitious materials (SCMs) shows promise as a strategy ... ...

Abstract	Increasing global cement and steel consumption means that a significant amount of greenhouse gases and metallurgical wastes are discharged every year. Using metallurgical waste as supplementary cementitious materials (SCMs) shows promise as a strategy for reducing greenhouse gas emissions by reducing cement production. This strategy also contributes to the utilization and management of waste resources. Controlled low-strength materials (CLSMs) are a type of backfill material consisting of industrial by-products that do not meet specification requirements. The preparation of CLSMs using metallurgical waste slag as the auxiliary cementing material instead of cement itself is a key feature of the sustainable development of the construction industry. Therefore, this paper reviews the recent research progress on the use of metallurgical waste residues (including blast furnace slag, steel slag, red mud, and copper slag) as SCMs to partially replace cement, as well as the use of alkali-activated metallurgical waste residues as cementitious materials to completely replace cement for the production of CLSMs. The general background information, mechanical features, and properties of pozzolanic metallurgical slag are introduced, and the relationship and mechanism of metallurgical slag on the performance and mechanical properties of CLSMs are analyzed. The analysis and observations in this article offer a new resource for SCM development, describe a basis for using metallurgical waste slag as a cementitious material for CLSM preparation, and offer a strategy for reducing the environmental problems associated with the treatment of metallurgical waste.
Language	English
Publishing date	2022-01-19
Publishing country	Switzerland
Document type	Journal Article ; Review
ZDB-ID	2487261-1
ISSN	1996-1944
ISSN	1996-1944
DOI	10.3390/ma15030727
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Article ; Online: Acetylated nanocellulose reinforced hydroxypropyl starch acetate realizing polypropylene replacement for green packaging application.

Yao, Fengbiao / Wu, Zhiqiang / Gu, Yongsheng / Di, Yong / Liu, Yiliang / Srinivasan, Vennila / Lian, Chenglong / Li, Yongfeng

Carbohydrate polymers

2024 Volume 331, Page(s) 121886

Abstract: The use of natural starch as a replacement for petroleum-based packaging materials is limited due to its poor processability, weak mechanical properties, and strong moisture sensitivity. To address these limitations, this study adopts molecular design of ...

Abstract	The use of natural starch as a replacement for petroleum-based packaging materials is limited due to its poor processability, weak mechanical properties, and strong moisture sensitivity. To address these limitations, this study adopts molecular design of hydroxypropylation and acetylation to sequentially modify natural starch, and material design of introducing acetylated cellulose nanofibers (ACNF) into the starch matrix to reinforce the material. Hydroxypropylation decreased the interaction force between the starch molecular chains, thereby reducing the glass transition temperature. Subsequent acetylation introduced hydrophobic acetyl groups that disrupted intermolecular hydrogen bonds, enhancing the mobility of the starch molecular chain, and endowed the hydroxypropyl starch acetate (HPSA) with excellent thermoplastic processability (melt index of 7.12 g/10 min) without the need for plasticizers and notable water resistance (water absorption rate of 3.0 %). The introduction of ACNF generated a strong interaction between HPSA chains, promoting the derived ACNF-HPSA to exhibit excellent mechanical strength, such as high impact strength of 2.1 kJ/m
Language	English
Publishing date	2024-02-01
Publishing country	England
Document type	Journal Article
ZDB-ID	1501516-6
ISSN	1879-1344 ; 0144-8617
ISSN (online)	1879-1344
ISSN	0144-8617
DOI	10.1016/j.carbpol.2024.121886
Database	MEDical Literature Analysis and Retrieval System OnLINE

Full text online

Accessible to users with ZB MED library card

Order via subito

Details ▾
- Full text online
- Order with fees

To top

Full text online

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

Full text online

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

Full text online

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

Order via subito

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED

Full text online

More links

Kategorien

Inter-library loan at ZB MED

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

Order via subito

More links

Kategorien

Order via subito

Full text online

More links

Kategorien

Order via subito