LIVIVO - Search results -

Search results

Result 1 - 10 of total 57

Search options

Article: Studies on seed transmission of “Candidatus Liberibacter solanacearum” in pepper and its impact on plant emergence

Workneh, Fekede / Paetzold, Li / Rush, Charles M.

Plant pathology. 2022 May, v. 71, no. 4

2022

Abstract: Candidatus Liberibacter solanacearum” (Lso), transmitted by the potato psyllid (Bactericera cockerelli), is the causal agent of potato zebra chip, but can also infect other solanaceous plants, including peppers. Studies were conducted to investigate ... ...

Abstract	“Candidatus Liberibacter solanacearum” (Lso), transmitted by the potato psyllid (Bactericera cockerelli), is the causal agent of potato zebra chip, but can also infect other solanaceous plants, including peppers. Studies were conducted to investigate whether Lso could be transmitted to the next generation of plants through seeds from infected pepper plants. In 2014, jalapeno pepper plants were infested with psyllids carrying a mixture of Lso A and B (AB) at the AgriLife Research Station at Bushland. The study was again conducted in 2019 and pepper plants were infested with psyllids carrying Lso B or Lso AB. In each of the studies, noninfested plants served as controls. At harvest, fruits were collected and tested for the presence of Lso using quantitative PCR. Seeds from infected fruits were then tested for Lso. Overall, the percentage of seeds that tested positive for Lso ranged from 33% to 70%. However, Lso detection in embryos ranged only from 0% to 8%. Seed samples from Lso‐positive fruits were planted in the greenhouse to determine the impact of Lso on emergence and the incidence of Lso in emerged plants. Although plant emergence differed between some of the seeds obtained from Lso‐positive and ‐negative fruits, the overall impact of Lso on plant emergence was not consistent. However, of the 182 plants that emerged from seeds collected from infected fruits, none was positive for Lso, suggesting that seeds are unlikely to serve as sources for new Lso infections and their impact on disease epidemiology is negligible.
Keywords	Bactericera cockerelli ; Candidatus Liberibacter solanacearum ; epidemiology ; greenhouses ; pepper ; plant pathology ; potatoes ; quantitative polymerase chain reaction ; zebra chip disease
Language	English
Dates of publication	2022-05
Size	p. 927-933.
Publishing place	John Wiley & Sons, Ltd
Document type	Article
Note	JOURNAL ARTICLE
ZDB-ID	415941-x
ISSN	1365-3059 ; 0032-0862
ISSN (online)	1365-3059
ISSN	0032-0862
DOI	10.1111/ppa.13526
Database	NAL-Catalogue (AGRICOLA)

In stock of ZB MED Bonn / Germany

Z 945: Show issues

Order via subito

This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: First Report of Sw-5 Resistance-Breaking Strain of Tomato spotted wilt virus (Orthotospovirus tomatomaculae) Infecting Tomato in Texas

Chinnaiah, Senthilraja / Gautam, Saurabh / Workneh, Fekede / Crosby, Kevin / Rush, Charles / Gadhave, Kiran R.

Plant Disease. 2023 Aug. 01, v. 107, no. 8 p.2569-

2023

Abstract: Tomato spotted wilt virus (Orthotospovirus tomatomaculae, referred to as TSWV hereafter) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene “Sw-5” offering a broad- ...

Abstract	Tomato spotted wilt virus (Orthotospovirus tomatomaculae, referred to as TSWV hereafter) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene “Sw-5” offering a broad-spectrum resistance to multiple orthotospoviruses was introduced in tomato cultivars. However, multiple resistance-breaking strains of TSWV were reported worldwide (Batuman et al. 2017; Ciuffo 2005; di Rienzo et al. 2018). Symptoms suggestive of orthotospoviral infection including stunting, bronzing, and inward rolling of leaves, and concentric necrotic spots on leaves, petioles, and fruits were observed in two TSWV-resistant tomato cultivars (‘BL163’ and ‘HT 2’) planted in a tomato variety trial in Bushland, TX, in 2022. Leaf tissues from 45 resistant tomato plants (symptomatic or asymptomatic) from both resistant cultivars were tested using a TaqMan probe-based qPCR assay targeting a 200-bp region in nucleoprotein (N) of the TSWV (Gautam et al. 2023). While 25 of those samples tested positive for TSWV, only 10 expressed characteristic disease symptoms described above. The possibility of mixed infection in those samples with other endemic viruses in the region, namely, alfalfa mosaic virus, groundnut ringspot orthotospovirus, tobacco mosaic virus, tomato chlorotic spot orthotospovirus, tomato mosaic virus, tomato necrotic streak virus, tomato ringspot virus, and tomato torrado virus, was discounted through RT-PCR analysis (Bratsch et al. 2018; Verbeek et al. 2012). To test the RB phenotype of the observed putative TSWV-RB strains, 3-week-old tomato plants from eight commercially available TSWV-resistant cultivars and one nonresistant cultivar (n = 10 each) were mechanically inoculated with leaf tissues collected from a single symptomatic plant from one of the field-grown resistant cultivars. The experiment was replicated twice. Hypersensitive response was observed on all inoculated leaves of resistant plants 1 week postinoculation. Furthermore, all eight resistant cultivars started expressing local and systemic TSW symptoms 12 to 16 days postinoculation (dpi), whereas the nonresistant cultivar started expressing symptoms at 9 dpi. TSW incidence across all resistant cultivars was 30 to 70%, whereas in the susceptible cultivar it was 90%. Symptoms exhibited by all resistant cultivars resembled those of symptoms observed in field-collected plants. The expression of the Sw-5 gene in all eight resistant cultivars and the lack thereof in a susceptible cultivar was confirmed using Sw-5b specific primers and using Actin as a housekeeping gene in qRT-PCR (Islam et al. 2022). The RB strains in Sw-5-resistant tomato in California (Batuman et al. 2017) had the C118Y mutation in the TSWV NSm protein, consistent with the original reporting of C118Y or T120N RB mutations in 11 TSWV isolates from Spain (NCBI accession nos. HM015517 and HM015518; Lopez et al. 2011). The nucleotide and amino acid sequence analysis of the NSm gene from Bushland RB isolates from four resistant cultivars (NCBI accession nos. OP810513-14 [field] and OQ247901-05 [mechanically inoculated]) shared 98.9 and 99.4% homology with the Californian NSm sequences of TSWV RB tomato isolates (KX898453 and ASO67371), respectively. While the NSm C118Y or T120N RB mutations were absent in all Bushland TSWV RB isolates, they had six additional unique point mutations across the NSm gene (I163V, P227Q, V290I, N293S, V294I, and K296Q), which could potentially be responsible for resistance breaking. Despite the lack of C118Y or T120N RB mutations, Bushland isolates were capable of disrupting Sw-5-mediated TSWV resistance in all eight commercial resistant tomato cultivars. This study suggests a new or a different class of fundamental mechanisms is likely to be responsible for resistance breaking in Sw-5b-resistant tomatoes. The new RB strain/s of TSWV therefore pose a substantial threat to tomato production in TX and other tomato-growing regions of the United States.
Keywords	Alfalfa mosaic virus ; Orthotospovirus ; Tobacco mosaic virus ; Tomato mosaic virus ; Tomato ringspot virus ; Tomato torrado virus ; actin ; amino acid sequences ; cultivars ; genes ; hypersensitive response ; leaves ; mixed infection ; mutation ; nucleoproteins ; peanuts ; phenotype ; reverse transcriptase polymerase chain reaction ; sequence analysis ; tomatoes ; viruses ; California ; Spain ; Texas ; agricultural pathogens ; new virus strains ; resistant tomato ; TSWV ; viral pathogens
Language	English
Dates of publication	2023-0801
Publishing place	The American Phytopathological Society
Document type	Article ; Online
ZDB-ID	754182-x
ISSN	0191-2917
ISSN	0191-2917
DOI	10.1094/PDIS-11-22-2699-PDN
Database	NAL-Catalogue (AGRICOLA)

In stock of ZB MED Bonn / Germany

Z 2043: Show issues

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: First Report of a Resistance-Breaking Strain of Tomato Spotted Wilt Orthotospovirus Infecting Capsicum annuum with the Tsw Resistance Gene in Texas

Gautam, Saurabh / Chinnaiah, Senthilraja / Workneh, Fekede / Crosby, Kevin / Rush, Charles / Gadhave, Kiran R.

Plant Disease. 2023 June 01, v. 107, no. 6 p.-1958

2023

Abstract: Since the first report of spotted wilt disease of tomato in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of >$1 billion annually (German et al. 1992). TSWV strains capable of ... ...

Abstract	Since the first report of spotted wilt disease of tomato in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of >$1 billion annually (German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been reported in multiple countries (Jiang et al. 2016), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the United States. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were seen in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) with the Tsw gene in Bushland, TX. In August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a qPCR assay targeting a coat protein of TSWV (TSWV-F: 5′-AGAGCATAATGAAGGTTATTAAGCAAAGTGA-3′; TSWV-R: 5′-GCCTGACCCTGATCAAGCTATC-3′; TaqMan probe: 5′-CAGTGGCTCCAATCCT-3′). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 had characteristic TSW symptoms, with disease incidence of 10 to 30% depending on the cultivar. The remaining 46 samples were asymptomatic, with no apparent hypersensitive response in leaves. To confirm the plant infectivity of RB strains, leaves pooled from six TSWV resistant plants were used to mechanically inoculate five noninfected, 3-week-old pepper plants from nine cultivars: seven TSWV resistant, one moderately resistant, and one susceptible (n = 3). Tsw expression in each resistant cultivar was confirmed using one-step qRT-PCR with primers specified in South Korean patent KR102000469B1 (Anil et al. 2019) used with leaves from a susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from nonresistant tomato plants infected with TSWV were used as a wild-type control. Three weeks postinoculation, characteristic TSW symptoms were observed in plants inoculated with the putative RB isolate; TSW incidence was 10 to 50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. No disease incidence was observed in resistant and moderately resistant plants, but 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR ∼5 to 7 days postinoculation. All symptomatic and 30 to 100% of asymptomatic TSWV-inoculated plants with RB or wild-type strains were positive for TSWV in probe-based qPCR analysis, confirming that no tested cultivar was immune to TSWV infection. All mock-inoculated plants tested negative in qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) from plants used in the mechanical inoculation (NCBI: OP548104) and inoculated resistant plants (NCBI: OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs T104A mutation responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI: KJ649609 and KJ649608; Almasi et al. 2017) was absent in all samples. Besides mutations, genetic reassortment as previously reported in South Korean TSWV RB pepper isolates (Kwon et al. 2021) and in other orthotospoviruses (Webster et al. 2011), could be an RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. These results indicate that potentially multiple new RB strains of TSWV capable of producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and threaten Texas pepper production.
Keywords	Capsicum annuum ; Orthotospovirus ; amino acids ; coat proteins ; cultivars ; disease incidence ; economic impact ; genomics ; hypersensitive response ; mutation ; necrosis ; pandemic ; pathogenicity ; pepper ; petioles ; polymerase chain reaction ; resistance genes ; sweet peppers ; tomatoes ; vascular wilt ; viruses ; Australia ; California ; Louisiana ; New Mexico ; Texas ; agricultural pathogens ; new virus strains ; resistant pepper ; TSWV ; viral pathogens
Language	English
Dates of publication	2023-0601
Size	p. -1958.
Publishing place	The American Phytopathological Society
Document type	Article ; Online
ZDB-ID	754182-x
ISSN	0191-2917
ISSN	0191-2917
DOI	10.1094/PDIS-09-22-2274-PDN
Database	NAL-Catalogue (AGRICOLA)

In stock of ZB MED Bonn / Germany

Z 2043: Show issues

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Transcriptional Responses of Resistant and Susceptible Wheat Exposed to Wheat Curl Mite.

Kiani, Mahnaz / Bryan, Becky / Rush, Charles / Szczepaniec, Adrianna

International journal of molecular sciences

2021 Volume 22, Issue 5

Abstract: 1) Background: The wheat curl mite ( ...

Abstract	(1) Background: The wheat curl mite (
MeSH term(s)	Animals ; Disease Resistance ; Gene Expression Profiling ; Gene Expression Regulation, Plant ; Mites ; Plant Diseases/parasitology ; Transcriptome ; Triticum/genetics ; Triticum/metabolism ; Triticum/parasitology
Language	English
Publishing date	2021-03-08
Publishing country	Switzerland
Document type	Journal Article
ZDB-ID	2019364-6
ISSN	1422-0067 ; 1422-0067 ; 1661-6596
ISSN (online)	1422-0067
ISSN	1422-0067 ; 1661-6596
DOI	10.3390/ijms22052703
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Article: Novel strains of a pandemic plant virus, tomato spotted wilt orthotospovirus, increase vector fitness and modulate virus transmission in a resistant host.

Chinnaiah, Senthilraja / Gautam, Saurabh / Herron, Benjamin / Workneh, Fekede / Rush, Charles M / Gadhave, Kiran R

Frontiers in microbiology

2023 Volume 14, Page(s) 1257724

Abstract: Tomato spotted wilt orthotospovirus (TSWV) is one of the most successful pandemic agricultural pathogens transmitted by several species of thrips in a persistent propagative manner. Current management strategies for TSWV heavily rely on growing single- ... ...

Abstract	Tomato spotted wilt orthotospovirus (TSWV) is one of the most successful pandemic agricultural pathogens transmitted by several species of thrips in a persistent propagative manner. Current management strategies for TSWV heavily rely on growing single-gene resistant cultivars of tomato ("
Language	English
Publishing date	2023-09-29
Publishing country	Switzerland
Document type	Journal Article
ZDB-ID	2587354-4
ISSN	1664-302X
ISSN	1664-302X
DOI	10.3389/fmicb.2023.1257724
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Article ; Online: Seed Transmission of Wheat Streak Mosaic Virus and Triticum Mosaic Virus in Differentially Resistant Wheat Cultivars.

Gautam, Saurabh / Chinnaiah, Senthilraja / Herron, Benjamin / Workneh, Fekede / Rush, Charles M / Gadhave, Kiran R

Viruses

2023 Volume 15, Issue 8

Abstract: Wheat streak mosaic virus (WSMV) and Triticum mosaic virus (TriMV) are important viral pathogens of wheat in the Great Plains. These viruses individually or in mixed infections with High Plains wheat mosaic virus cause a devastating wheat streak mosaic ( ... ...

Abstract	Wheat streak mosaic virus (WSMV) and Triticum mosaic virus (TriMV) are important viral pathogens of wheat in the Great Plains. These viruses individually or in mixed infections with High Plains wheat mosaic virus cause a devastating wheat streak mosaic (WSM) disease. Although seed transmission of WSMV has been studied, no information is currently available on that of TriMV. Furthermore, no study has explored the implications of mixed infections of WSMV and TriMV on seed transmission of one or both viruses. To study both aspects, seeds from differentially resistant field-grown wheat plants (cv. TAM 304 (susceptible), Joe (WSMV resistant,
MeSH term(s)	Coinfection ; Seeds ; Potyviridae/genetics
Language	English
Publishing date	2023-08-21
Publishing country	Switzerland
Document type	Journal Article ; Research Support, Non-U.S. Gov't
ZDB-ID	2516098-9
ISSN	1999-4915 ; 1999-4915
ISSN (online)	1999-4915
ISSN	1999-4915
DOI	10.3390/v15081774
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Article: First report of Sw-5 resistance-breaking strain of tomato spotted wilt orthotospovirus infecting tomato in Texas.

Chinnaiah, Senthilraja / Gautam, Saurabh / Workneh, Fekede / Crosby, Kevin / Rush, Charles / Gadhave, Kiran R

Plant disease

2023

Abstract: Tomato spotted wilt orthotospovirus (TSWV) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene 'Sw-5' offering a broad-spectrum resistance to multiple ... ...

Abstract	Tomato spotted wilt orthotospovirus (TSWV) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene 'Sw-5' offering a broad-spectrum resistance to multiple orthotospoviruses was introduced in tomato cultivars. However, multiple resistance-breaking strains of TSWV were reported worldwide (Ciuffo 2005; Zaccardelli et al. 2008; Batuman et al. 2017; di Rienzo et al. 2018). Symptoms suggestive of orthotospoviral infection including stunting, bronzing, and inward rolling of leaves, and concentric necrotic spots on leaves, petioles, and fruits were observed in two TSWV-resistant tomato cultivars ('BL163' and 'HT 2') planted in a tomato variety trial in Bushland, TX in 2022. Leaf tissues from 45 resistant tomato plants (symptomatic or asymptomatic) from both resistant cultivars were tested using a TaqMan probe-based qPCR assay targeting a 200bp region in nucleoprotein (N) of the TSWV (Gautam et al. 2022). While 25 of those samples tested positive for TSWV, only ten expressed characteristic disease symptoms described above. The possibility of mixed infection in those samples with other endemic viruses in the region viz., alfalfa mosaic virus, groundnut ringspot orthotospovirus, tobacco mosaic virus, tomato chlorotic spot orthotospovirus, tomato mosaic virus, tomato necrotic streak virus, tomato ringspot virus, and tomato torrado virus was discounted through RT-PCR analysis (Kumar et al. 2011; Verbeek et al. 2012; Bratsch et al. 2018). To test the RB phenotype of the observed putative TSWV-RB strains, three-week-old tomato plants from eight commercially available TSWV resistant cultivars and one non-resistant cultivar (n=10 each) were mechanically inoculated with leaf tissues collected from a single symptomatic plant from one of the field-grown resistant cultivars. The experiment was replicated twice. Hypersensitive response was observed on all inoculated leaves of resistant plants one week post inoculation. Furthermore, all eight resistant cultivars started expressing local and systemic TSW symptoms 12 to 16 days post inoculation (dpi), while non-resistant cultivar started expressing symptoms at 9 dpi. TSW incidence across all resistant cultivars was 30-70%, while in susceptible cultivar it was 90%. Symptoms exhibited by all resistant cultivars resembled those of symptoms observed in field collected plants. The expression of Sw-5 gene in all eight resistant cultivars and the lack thereof in a susceptible cultivar was confirmed using Sw-5b specific primers and using Actin as a housekeeping gene in qRT-PCR (Islam et al. 2022). The RB strains in Sw-5 resistant tomato in California (Batuman et al. 2017) had the C118Y mutation in the TSWV NSm protein, consistent with the original reporting of C118Y or T120N RB mutations in 11 TSWV isolates from Spain (NCBI accession # HM015517 & HM015518) (Lopez et al. 2011). The nucleotide and amino acid sequence analysis of NSm gene from Bushland RB isolates from four resistant cultivars (NCBI accessions # OP810513-14 [field], OQ247901-05 [mechanically inoculated]) shared 98.9 and 99.4% homology with the Californian NSm sequences of TSWV RB tomato isolate (KX898453 and ASO67371), respectively. While the Nsm C118Y or T120N RB mutations were absent in all Bushland TSWV RB isolates, they had six additional unique point mutations across the NSm (I163V, P227Q, V290I, N293S, V294I, K296Q), which could potentially be responsible for resistance breaking. Despite the lack of C118Y or T120N RB mutations, Bushland isolates were capable of disrupting Sw-5-mediated TSWV resistance in all eight commercial resistant tomato cultivars. This study suggests a new or a different class of fundamental mechanisms are likely to be responsible for resistance breaking in Sw-5b resistant tomatoes. The new RB strain/s of TSWV therefore pose a substantial threat to tomato production in TX and other tomato-growing regions of the US.
Language	English
Publishing date	2023-03-14
Publishing country	United States
Document type	Journal Article
ZDB-ID	754182-x
ISSN	0191-2917
ISSN	0191-2917
DOI	10.1094/PDIS-11-22-2699-PDN
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Bonn / Germany

Z 2043: Show issues

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

Article: Interactions Between Solanaceous Crops and ‘Candidatus Liberibacter solanacearum’ Haplotypes in Relation to Infection and Psyllid Survival on the Hosts

Workneh, Fekede / Paetzold, Li / Rush, Charles M

Plant disease. 2020 Jan., v. 104, no. 1

2020

Abstract: Candidatus Liberibacter solanacearum’ (Lso), transmitted by the potato psyllid (Bactericera cockerelli), is the putative causal agent of potato zebra chip disease. The bacterial pathogen infects a wide range of solanaceous plants (both wild and ... ...

Abstract	‘Candidatus Liberibacter solanacearum’ (Lso), transmitted by the potato psyllid (Bactericera cockerelli), is the putative causal agent of potato zebra chip disease. The bacterial pathogen infects a wide range of solanaceous plants (both wild and cultivated species), among which are peppers, potatoes, and tomatoes. Currently there are two commonly detected, genetically distinct haplotypes of Lso (A and B) identified from potatoes in the United States. To determine whether there are interactions between Lso haplotypes and different solanaceous hosts, experiments were conducted in the greenhouse in which pepper, potato, and tomato plants were infested with psyllids carrying Lso A, B, or an A and B mix (AB) or with psyllids free of Lso. Host plants were grown in pots in cages on the greenhouse benches and infested with six psyllids per plant. In addition, eight pepper cultivars were similarly infested for deeper understanding of host–haplotype interactions. Approximately 7 weeks after infestation, adult psyllids in each cage were counted to determine the impact of Lso haplotype–host interactions on psyllid survival and plants were sampled and tested molecularly for Lso. Individual psyllids carrying haplotypes B or AB and those free of Lso copiously reproduced on all three hosts, and leaf tissue from each plant tested positive for the respective Lso except those infested with Lso-negative psyllids. However, psyllids carrying Lso A did not survive on peppers but survived and abundantly reproduced on potatoes and tomatoes. In addition, samples from peppers infested with psyllids carrying Lso A tested negative for Lso. However, peppers infested with individual psyllids carrying Lso AB tested positive for Lso A, indicating that the presence of B may be required for infection by Lso A and psyllid survival on peppers. The different pepper cultivars infested with psyllids carrying Lso A showed similar results to the haplotype–host interaction tests, suggesting that cultivar may not be a factor in Lso A–pepper host interactions. Results from these studies suggest that Lso A may affect host selection by psyllids either for nutrition or laying of eggs. Mechanisms involved in preventing psyllid reproduction on peppers, once identified, will have significant implications for potential psyllid management.
Keywords	Bactericera cockerelli ; cages ; Candidatus Liberibacter solanacearum ; cultivars ; eggs ; greenhouses ; haplotypes ; host plants ; host preferences ; imagos ; leaves ; nutrition ; pathogens ; pepper ; peppers ; potatoes ; reproduction ; Solanum lycopersicum ; tomatoes ; zebra chip disease ; United States
Language	English
Dates of publication	2020-01
Size	p. 179-185.
Publishing place	Plant Disease
Document type	Article
ZDB-ID	754182-x
ISSN	0191-2917
ISSN	0191-2917
DOI	10.1094/PDIS-12-18-2258-RE
Database	NAL-Catalogue (AGRICOLA)

In stock of ZB MED Bonn / Germany

Z 2043: Show issues

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

Article: First report of a resistance-breaking strain of tomato spotted wilt orthotospovirus infecting Capsicum annuum with the Tsw resistance gene in Texas.

Gautam, Saurabh / Chinnaiah, Senthilraja / Workneh, Fekede / Crosby, Kevin / Rush, Charles / Gadhave, Kiran R

Plant disease

2022

Abstract: Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German ... ...

Abstract	Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.
Language	English
Publishing date	2022-11-16
Publishing country	United States
Document type	Journal Article
ZDB-ID	754182-x
ISSN	0191-2917
ISSN	0191-2917
DOI	10.1094/PDIS-09-22-2274-PDN
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Bonn / Germany

Z 2043: Show issues

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

Article: Interactions Between Solanaceous Crops and '

Workneh, Fekede / Paetzold, Li / Rush, Charles M

Plant disease

2019 Volume 104, Issue 1, Page(s) 179–185

Abstract: ...

Abstract	'
MeSH term(s)	Animals ; Haplotypes ; Hemiptera/microbiology ; Host-Pathogen Interactions ; Plant Diseases/microbiology ; Rhizobiaceae ; Solanaceae/microbiology
Language	English
Publishing date	2019-11-13
Publishing country	United States
Document type	Journal Article
ZDB-ID	754182-x
ISSN	0191-2917
ISSN	0191-2917
DOI	10.1094/PDIS-12-18-2258-RE
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Bonn / Germany

Z 2043: Show issues

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

To top

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

Order via subito

More links

Kategorien

Order via subito

More links

Kategorien

Order via subito

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED