LIVIVO - Search results -

Search results

Result 1 - 10 of total 29

Search options

Article: Assessment of prickly sida as a potential inoculum source for sida golden mosaic virus in commercial snap bean farms in Georgia, United States.

Codod, Clarence / Severns, Paul / Sparks, Alton N / Srinivasan, Rajagopalbabu / Kemerait, Robert / Dutta, Bhabesh

2024

Abstract: Sida golden mosaic virus (SiGMV), an obligate pathogen that infects snap beans (Phaseolus vulgaris), is known to infect prickly sida (Sida spinosa L.), which is a common weed in agricultural farms in Georgia. Prickly sida has also been reported as a ... ...

Abstract	Sida golden mosaic virus (SiGMV), an obligate pathogen that infects snap beans (Phaseolus vulgaris), is known to infect prickly sida (Sida spinosa L.), which is a common weed in agricultural farms in Georgia. Prickly sida has also been reported as a suitable host of sweetpotato whitefly (Bemisia tabaci), the vector of SiGMV. Despite being a host for both SiGMV and its vector, the role of prickly sida as a reservoir and inoculum source for SiGMV in snap bean farms has not been evaluated. This study was conducted to document the occurrence of SiGMV-infected prickly sida plants and to assess its potential role as a source of SiGMV inoculum in snap bean farms. A survey of 17 commercial snap bean farms conducted in spring 2021 confirmed the presence of SiGMV-infected prickly sida in southern Georgia. In fall 2021 and 2022, on-farm field trials were conducted in four commercial farms where SiGMV-infected prickly sida plants were documented earlier as a part of survey in spring 2021. The spatial distribution and temporal patterns of adult whiteflies and SiGMV on snap bean were compared between macroplots (13.7 m x 30.5 m), 'with prickly sida' or 'without prickly sida', that were at least 232 m apart from each other. We did not observe any consistent differences in counts of adult whiteflies between macroplots with or without prickly sida in the four commercial farms. SiGMV infection was detected earlier and with higher incidences in snap bean macroplots 'with prickly sida' compared with macroplots 'without prickly sida'. An apparent disease gradient was observed in two of the four farms assessed. Higher SiGMV incidences were observed on the edges of macroplots 'with prickly sida'. These findings indicate prickly sida as a potential natural reservoir and a source for SiGMV spread in snap bean farms in southern Georgia.
Language	English
Publishing date	2024-01-19
Publishing country	United States
Document type	Journal Article
ZDB-ID	754182-x
ISSN	0191-2917
ISSN	0191-2917
DOI	10.1094/PDIS-09-23-1901-RE
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Bonn / Germany

Z 2043: Show issues

Order via subito

This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Post-Application Field Persistence and Efficacy of

Wu, Shaohui / Toews, Michael D / Behle, Robert W / Barman, Apurba K / Sparks, Alton N / Simmons, Alvin M / Shapiro-Ilan, David I

Journal of fungi (Basel, Switzerland)

2023 Volume 9, Issue 8

Abstract: Previously, ...

Abstract	Previously,
Language	English
Publishing date	2023-08-05
Publishing country	Switzerland
Document type	Journal Article
ZDB-ID	2784229-0
ISSN	2309-608X ; 2309-608X
ISSN (online)	2309-608X
ISSN	2309-608X
DOI	10.3390/jof9080827
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Article: Characterization of the spatial distribution of the whitefly-transmitted virus complex in yellow squash fields in Southern Georgia, USA

Codod, Clarence B. / Severns, Paul M. / Sparks, Alton N. / Srinivasan, Rajagopalbabu / Kemerait, Robert C. / Dutta, Bhabesh

Frontiers in agronomy. 2022 Aug., v. 4

2022

Abstract: A two-year study was conducted in 2019 and 2020 to characterize the spatial distribution of whitefly-transmitted virus complex (WTVC) in experimental and commercial yellow squash (Cucurbita pepo) fields in southern Georgia, USA. Field trials planted in ... ...

Abstract	A two-year study was conducted in 2019 and 2020 to characterize the spatial distribution of whitefly-transmitted virus complex (WTVC) in experimental and commercial yellow squash (Cucurbita pepo) fields in southern Georgia, USA. Field trials planted in Tifton, Georgia, USA were comprised of 30 rows of squash (variety: Gentry) divided into 300 quadrats. Six commercial fields in Tift, Worth, and Colquitt Counties in Georgia, USA were surveyed. In each field, 10 rows of plants per field were partitioned into 70 quadrats so that their approximate location could be mapped and disease incidence tracked in space over time. Plants in each quadrat were visually assessed for TVC symptoms at seven-day intervals (experimental fields) or at fourteen-day intervals (commercial fields). The spatial distribution of WTVC in a one-dimensional space was determined through ordinary runs analysis and in two-dimensional space through spatial autocorrelation analysis and spatial analysis by distance indices (SADIE). Ordinary runs analysis down and between rows suggested that disease was more likely to be transmitted from infected plants within rows than across rows. WTVC incidence in space was positively correlated with adult whiteflies on squash leaves taken one or two weeks prior to the assessment of virus incidence coinciding with latent period of Geminiviruses. SADIE generated disease severity maps indicated a shift from sparse and randomly distributed disease early in the infection cycle to denser, more aggregated patterns later in time in both experimental and commercial fields. Contour plots of interpolated indices from SADIE analysis suggested an edge effect on the spatial distribution of WTVC in experimental fields as well as in two of the commercial fields. An understanding of the shift from random to aggregated distribution and the edge effect on WTVC incidence are considerations for refining current management strategies.
Keywords	Cucurbita pepo ; Geminiviridae ; adults ; agronomy ; autocorrelation ; disease incidence ; disease severity ; edge effects ; latent period ; squashes ; viruses ; Georgia
Language	English
Dates of publication	2022-08
Publishing place	Frontiers Media S.A.
Document type	Article
ISSN	2673-3218
DOI	10.3389/fagro.2022.930388
Database	NAL-Catalogue (AGRICOLA)

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Article: Reproductive Biology and Evidence of Diapause in the Cowpea Curculio (Coleoptera: Curculionidae)

Riley, David G / Barwick, Sydni / Sparks, Alton N / Harty, Thomas / Hamadi, Negin

Journal of economic entomology. 2019 Dec. 31, v. 113, no. 2

2019

Abstract: Chalcodermus aeneus Boheman (Coleoptera: Curculionidae) has been the most destructive insect pest of black-eyed peas or cowpeas, Vigna unguiculata L. (Fabales: Fabaceae), over the last century in the southeastern United States. The historical ... ...

Abstract	Chalcodermus aeneus Boheman (Coleoptera: Curculionidae) has been the most destructive insect pest of black-eyed peas or cowpeas, Vigna unguiculata L. (Fabales: Fabaceae), over the last century in the southeastern United States. The historical distribution of this semitropical pest suggests the likelihood that diapause plays a key role in the overwintering success in parts of the United States. However, this report is the first to document biological evidence for diapause in C. aeneus. Our study assessed larval emergence from cowpea pods in the summer to fall growing seasons, egg development in female adults over the first (summer) and second (fall) generations, and adult emergence from infested soil after the first and second generations.There was a clear reduction in larval emergence from summer to fall. Egg and follicle development in female C. aeneus dropped off dramatically by September of each year.There was an extended emergence pattern of weevil adults from the soil in the fall as compared to the summer generation. Any future regional management of cowpea curculio will have to take into account the ability of this insect to diapause, thereby increasing its capacity to overwinter in regions where the cowpea crop, a warm-season, semitropical plant, is terminated with winter freezing temperatures.
Keywords	Chalcodermus aeneus ; Vigna unguiculata ; cowpeas ; diapause ; eggs ; entomology ; females ; insect pests ; larvae ; overwintering ; soil ; summer ; warm season
Language	English
Dates of publication	2019-1231
Size	p. 882-886.
Publishing place	Entomological Society of America
Document type	Article
Note	NAL-AP-2-clean
ZDB-ID	3031-4
ISSN	0022-0493
ISSN	0022-0493
DOI	10.1093/jee/toz349
Database	NAL-Catalogue (AGRICOLA)

In stock of ZB MED Bonn / Germany

Z 1776: Show issues

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

Article: Survey of Bemisia tabaci (Hemiptera: Aleyrodidae) in Agricultural Ecosystems in Georgia

McKenzie, Cindy L / Sparks, Alton N / Roberts, Phillip / Oetting, Ronald D / Osborne, Lance S

Journal of entomological science. 2020 Mar. 30, v. 55, no. 2

2020

Abstract: Bemisia tabaci (Gennaduis) is a large complex of cryptic species whose members are invasive pests of economically important commodities, including cotton, vegetables, and ornamental crops. A new state detection of Mediterranean (MED; biotype Q) whitefly ... ...

Abstract	Bemisia tabaci (Gennaduis) is a large complex of cryptic species whose members are invasive pests of economically important commodities, including cotton, vegetables, and ornamental crops. A new state detection of Mediterranean (MED; biotype Q) whitefly on poinsettia from a commercial greenhouse was made in Wisconsin in July 2018, bringing the total positive MED whitefly states to 27, indicating that MED is still expanding its geographical range in the United States. Middle Eastern Asia Minor 1 (MEAM1; biotype B) and MED whiteflies were the primary targets for this survey of agricultural ecosystems from field, greenhouse, and nursery plants. Seventy samples were collected from 19 crops across 23 counties in Georgia, with the bulk of the samples taken in 2016 and 2017. Five whitefly samples were collected in both 2011 and 2012, representing nine counties and five different host plants (verbena, lantana, pepper, cucumber, and poinsettia). Overall, cotton was the most heavily sampled commodity (n = 27), followed by 7 samples of bell or ornamental pepper and 6 samples each of poinsettia, peanut, and squash. Other crops sampled included soybean, cowpea, corn, snap bean, zucchini, kale, tomato, sweet potato, eggplant, cantaloupe, and mum. MED whitefly of the B. tabaci cryptic species complex was detected on verbena and lantana in 2011 and poinsettia in 2012 at commercial greenhouses. Only MEAM1 whitefly was detected in all the field grown commodities sampled in Georgia regardless of the year. This survey serves as a baseline for Georgia in the event that MED whiteflies are eventually detected in the field.
Keywords	Bemisia tabaci ; Chrysanthemum morifolium ; Euphorbia pulcherrima ; agroecosystems ; biotypes ; cantaloupes ; corn ; cotton ; cowpeas ; cryptic species ; cucumbers ; eggplants ; green beans ; greenhouses ; host plants ; kale ; nursery crops ; ornamental plants ; peanuts ; pepper ; pests ; soybeans ; surveys ; sweet potatoes ; tomatoes ; zucchini ; Georgia ; Wisconsin
Language	English
Dates of publication	2020-0330
Size	p. 163-170.
Publishing place	Georgia Entomological Society
Document type	Article
ZDB-ID	12629-9
ISSN	0749-8004
ISSN	0749-8004
DOI	10.18474/0749-8004-55.2.163
Database	NAL-Catalogue (AGRICOLA)

In stock of ZB MED Bonn / Germany

Z 4546: Show issues

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

Article: First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia.

Kavalappara, Saritha Raman / Milner, Hayley / Sparks, Alton N / McGregor, Cecilia / Wintermantel, William M / Bag, Sudeep

Plant disease

2021

Abstract: Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf ... ...

Abstract	Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.
Language	English
Publishing date	2021-01-08
Publishing country	United States
Document type	Journal Article
ZDB-ID	754182-x
ISSN	0191-2917
ISSN	0191-2917
DOI	10.1094/PDIS-11-20-2429-PDN
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Bonn / Germany

Z 2043: Show issues

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾
- See ZB MED holdings
- Order with fees

Article: High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA

Kavalappara, Saritha Raman / Milner, Hayley / Konakalla, Naga Charan / Morgan, Kaelyn / Sparks, Alton N. / McGregor, Cecilia / Culbreath, Albert K. / Wintermantel, William M. / Bag, Sudeep

Viruses. 2021 May 26, v. 13, no. 6

2021

Abstract: Viruses transmitted by the sweet potato whitefly (Bemisia tabaci) have been detrimental to the sustainable production of cucurbits in the southeastern USA. Surveys were conducted in the fall of 2019 and 2020 in Georgia, a major cucurbit-producing state ... ...

Abstract	Viruses transmitted by the sweet potato whitefly (Bemisia tabaci) have been detrimental to the sustainable production of cucurbits in the southeastern USA. Surveys were conducted in the fall of 2019 and 2020 in Georgia, a major cucurbit-producing state of the USA, to identify the viruses infecting cucurbits and their distribution. Symptomatic samples were collected and small RNA libraries were prepared and sequenced from three cantaloupes, four cucumbers, and two yellow squash samples. An analysis of the sequences revealed the presence of the criniviruses cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and the begomovirus cucurbit leaf crumple virus (CuLCrV). CuLCrV was detected in 76%, CCYV in 60%, and CYSDV in 43% of the total samples (n = 820) tested. The level of mixed infections was high in all the cucurbits, with most plants tested being infected with at least two of these viruses. Near-complete genome sequences of two criniviruses, CCYV and CYSDV, were assembled from the small RNA sequences. An analysis of the coding regions showed low genetic variability among isolates from different hosts. In phylogenetic analysis, the CCYV isolates from Georgia clustered with Asian isolates, while CYSDV isolates clustered with European and USA isolates. This work enhances our understanding of the distribution of viruses on cucurbits in South Georgia and will be useful to develop strategies for managing the complex of whitefly-transmitted viruses in the region.
Keywords	Bemisia tabaci ; Cucurbit leaf crumple virus ; Cucurbitaceae ; RNA ; genetic variation ; genome ; phylogeny ; squashes ; surveys ; viruses ; Georgia
Language	English
Dates of publication	2021-0526
Publishing place	Multidisciplinary Digital Publishing Institute
Document type	Article
ZDB-ID	2516098-9
ISSN	1999-4915
ISSN	1999-4915
DOI	10.3390/v13060988
Database	NAL-Catalogue (AGRICOLA)

Order via subito

Article ; Online: Reproductive Biology and Evidence of Diapause in the Cowpea Curculio (Coleoptera: Curculionidae).

Riley, David G / Barwick, Sydni / Sparks, Alton N / Harty, Thomas / Hamadi, Negin

Journal of economic entomology

2019 Volume 113, Issue 2, Page(s) 882–886

Abstract	Chalcodermus aeneus Boheman (Coleoptera: Curculionidae) has been the most destructive insect pest of black-eyed peas or cowpeas, Vigna unguiculata L. (Fabales: Fabaceae), over the last century in the southeastern United States. The historical distribution of this semitropical pest suggests the likelihood that diapause plays a key role in the overwintering success in parts of the United States. However, this report is the first to document biological evidence for diapause in C. aeneus. Our study assessed larval emergence from cowpea pods in the summer to fall growing seasons, egg development in female adults over the first (summer) and second (fall) generations, and adult emergence from infested soil after the first and second generations. There was a clear reduction in larval emergence from summer to fall. Egg and follicle development in female C. aeneus dropped off dramatically by September of each year. There was an extended emergence pattern of weevil adults from the soil in the fall as compared to the summer generation. Any future regional management of cowpea curculio will have to take into account the ability of this insect to diapause, thereby increasing its capacity to overwinter in regions where the cowpea crop, a warm-season, semitropical plant, is terminated with winter freezing temperatures.
MeSH term(s)	Animals ; Coleoptera ; Diapause ; Diapause, Insect ; Female ; Southeastern United States ; Vigna ; Weevils
Language	English
Publishing date	2019-12-30
Publishing country	England
Document type	Journal Article ; Research Support, Non-U.S. Gov't
ZDB-ID	3031-4
ISSN	1938-291X ; 0022-0493
ISSN (online)	1938-291X
ISSN	0022-0493
DOI	10.1093/jee/toz349
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.B 1118: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA.

Kavalappara, Saritha Raman / Milner, Hayley / Konakalla, Naga Charan / Morgan, Kaelyn / Sparks, Alton N / McGregor, Cecilia / Culbreath, Albert K / Wintermantel, William M / Bag, Sudeep

Viruses

2021 Volume 13, Issue 6

Abstract: Viruses transmitted by the sweet potato whitefly ( ...

Abstract	Viruses transmitted by the sweet potato whitefly (
MeSH term(s)	Animals ; Coinfection/virology ; Crinivirus/genetics ; Crinivirus/isolation & purification ; Genome, Viral ; Georgia/epidemiology ; Hemiptera/virology ; High-Throughput Nucleotide Sequencing ; Metagenomics/methods ; Phenotype ; Phylogeny ; Plant Diseases/virology ; Plant Viruses/classification ; Plant Viruses/genetics ; Prevalence ; RNA, Viral
Chemical Substances	RNA, Viral
Language	English
Publishing date	2021-05-26
Publishing country	Switzerland
Document type	Journal Article ; Research Support, U.S. Gov't, Non-P.H.S.
ZDB-ID	2516098-9
ISSN	1999-4915 ; 1999-4915
ISSN (online)	1999-4915
ISSN	1999-4915
DOI	10.3390/v13060988
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Book ; Audio / Video: A key to common caterpillar pests of vegetables

Sparks, Alton N

(B / Texas Agricultural Extension Service ; 6110)

2001

Author's details	A.N. Sparks, Jr. and T.-X. Liu
Series title	B / Texas Agricultural Extension Service ; 6110
Language	English
Publisher	Texas Agricultural Extension Service, Texas A&M University System
Publishing place	College Station, Tex.
Document type	Book ; Audio / Video
Note	Caption title. ; "7-01."
Database	NAL-Catalogue (AGRICOLA)

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Details ▾

To top

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

Order via subito

More links

Kategorien

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

In stock of ZB MED Bonn / Germany

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

Order via subito

More links

Kategorien

Inter-library loan at ZB MED