LIVIVO - Search results -

Search results

Result 1 - 10 of total 19

Search options

Article ; Online: Rac1 promotes kidney collecting duct repair by mechanically coupling cell morphology to mitotic entry.

Bock, Fabian / Dong, Xinyu / Li, Shensen / Viquez, Olga M / Sha, Eric / Tantengco, Matthew / Hennen, Elizabeth M / Plosa, Erin / Ramezani, Alireza / Brown, Kyle L / Whang, Young Mi / Terker, Andrew S / Arroyo, Juan Pablo / Harrison, David G / Fogo, Agnes / Brakebusch, Cord H / Pozzi, Ambra / Zent, Roy

Science advances

2024 Volume 10, Issue 6, Page(s) eadi7840

Abstract: Prolonged obstruction of the ureter, which leads to injury of the kidney collecting ducts, results in permanent structural damage, while early reversal allows for repair. Cell structure is defined by the actin cytoskeleton, which is dynamically organized ...

Abstract	Prolonged obstruction of the ureter, which leads to injury of the kidney collecting ducts, results in permanent structural damage, while early reversal allows for repair. Cell structure is defined by the actin cytoskeleton, which is dynamically organized by small Rho guanosine triphosphatases (GTPases). In this study, we identified the Rho GTPase, Rac1, as a driver of postobstructive kidney collecting duct repair. After the relief of ureteric obstruction, Rac1 promoted actin cytoskeletal reconstitution, which was required to maintain normal mitotic morphology allowing for successful cell division. Mechanistically, Rac1 restricted excessive actomyosin activity that stabilized the negative mitotic entry kinase Wee1. This mechanism ensured mechanical G
MeSH term(s)	Kidney Tubules, Collecting/metabolism ; rac1 GTP-Binding Protein/metabolism ; Cytoskeleton/metabolism ; Actins/metabolism ; Actin Cytoskeleton/metabolism
Chemical Substances	rac1 GTP-Binding Protein (EC 3.6.5.2) ; Actins
Language	English
Publishing date	2024-02-07
Publishing country	United States
Document type	Journal Article
ZDB-ID	2810933-8
ISSN	2375-2548 ; 2375-2548
ISSN (online)	2375-2548
ISSN	2375-2548
DOI	10.1126/sciadv.adi7840
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

Article: HLA-BAT1 alters migration, invasion and pro-inflammatory cytokines in prostate cancer.

García-Vargas, Aileen M / Roque-Reyes, Yarelis M / Arroyo-Villegas, Desiree M / Santiago-Negron, Daniel / Sánchez-Vázquez, María M / Rivera-Torres, Alejandro / Reyes-Meléndez, Andrea C / Cardona-Berdecía, Valerie / García-Maldonado, Miosotis / Víquez, Olga M / Martínez-Ferrer, Magaly

Frontiers in oncology

2022 Volume 12, Page(s) 969396

Abstract: Prostate cancer (PCa) accounts for more than 1 in 5 diagnoses and is the second cause of cancer-related deaths in men. Although PCa may be successfully treated, patients may undergo cancer recurrence and there is a need for new biomarkers to improve the ... ...

Abstract	Prostate cancer (PCa) accounts for more than 1 in 5 diagnoses and is the second cause of cancer-related deaths in men. Although PCa may be successfully treated, patients may undergo cancer recurrence and there is a need for new biomarkers to improve the prediction of prostate cancer recurrence and improve treatment. Our laboratory demonstrated that HLA-B-associated transcript 1 (BAT1) was differentially expressed in patients with high Gleason scores when compared to low Gleason scores. BAT1 is an anti-inflammatory gene but its role in PCa has not been identified. The objective of this study is to understand the role of BAT1 in prostate cancer.
Language	English
Publishing date	2022-11-23
Publishing country	Switzerland
Document type	Journal Article
ZDB-ID	2649216-7
ISSN	2234-943X
ISSN	2234-943X
DOI	10.3389/fonc.2022.969396
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Article ; Online: The laminin-binding integrins regulate nuclear factor κB-dependent epithelial cell polarity and inflammation.

Yazlovitskaya, Eugenia M / Plosa, Erin / Bock, Fabian / Viquez, Olga M / Mernaugh, Glenda / Gewin, Leslie S / De Arcangelis, Adele / Georges-Labouesse, Elisabeth / Sonnenberg, Arnoud / Blackwell, Timothy S / Pozzi, Ambra / Zent, Roy

Journal of cell science

2021 Volume 134, Issue 24

Abstract: The main laminin-binding integrins α3β1, α6β1 and α6β4 are co-expressed in the developing kidney collecting duct system. We previously showed that deleting the integrin α3 or α6 subunit in the ureteric bud, which gives rise to the kidney collecting ... ...

Abstract	The main laminin-binding integrins α3β1, α6β1 and α6β4 are co-expressed in the developing kidney collecting duct system. We previously showed that deleting the integrin α3 or α6 subunit in the ureteric bud, which gives rise to the kidney collecting system, caused either a mild or no branching morphogenesis phenotype, respectively. To determine whether these two integrin subunits cooperate in kidney collecting duct development, we deleted α3 and α6 in the developing ureteric bud. The collecting system of the double knockout phenocopied the α3 integrin conditional knockout. However, with age, the mice developed severe inflammation and fibrosis around the collecting ducts, resulting in kidney failure. Integrin α3α6-null collecting duct epithelial cells showed increased secretion of pro-inflammatory cytokines and displayed mesenchymal characteristics, causing loss of barrier function. These features resulted from increased nuclear factor kappa-B (NF-κB) activity, which regulated the Snail and Slug (also known as Snai1 and Snai2, respectively) transcription factors and their downstream targets. These data suggest that laminin-binding integrins play a key role in the maintenance of kidney tubule epithelial cell polarity and decrease pro-inflammatory cytokine secretion by regulating NF-κB-dependent signaling.
MeSH term(s)	Animals ; Epithelial Cells ; Inflammation/genetics ; Integrin alpha3beta1 ; Integrins/genetics ; Kidney Tubules, Collecting ; Laminin/genetics ; Mice ; NF-kappa B/genetics
Chemical Substances	Integrin alpha3beta1 ; Integrins ; Laminin ; NF-kappa B
Language	English
Publishing date	2021-12-22
Publishing country	England
Document type	Journal Article ; Research Support, N.I.H., Extramural ; Research Support, Non-U.S. Gov't ; Research Support, U.S. Gov't, Non-P.H.S.
ZDB-ID	2993-2
ISSN	1477-9137 ; 0021-9533
ISSN (online)	1477-9137
ISSN	0021-9533
DOI	10.1242/jcs.259161
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 1200: Show issues			Location: Je nach Verfügbarkeit (siehe Angabe bei Bestand) bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular Jg. 1995 - 2021: Lesesall (1.OG) ab Jg. 2022: Lesesaal (EG)
Zs.MG 14: Show issues

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: The laminin binding α3 and α6 integrins cooperate to promote epithelial cell adhesion and growth.

Yazlovitskaya, Eugenia M / Viquez, Olga M / Tu, Tianxiang / De Arcangelis, Adele / Georges-Labouesse, Elisabeth / Sonnenberg, Arnoud / Pozzi, Ambra / Zent, Roy

Matrix biology : journal of the International Society for Matrix Biology

2018 Volume 77, Page(s) 101–116

Abstract: Integrins, the major receptors for cell-extracellular matrix (ECM) interactions, regulate multiple cell biological processes including adhesion, migration, proliferation and growth factor-dependent signaling. The principal laminin (LM) binding integrins ... ...

Abstract	Integrins, the major receptors for cell-extracellular matrix (ECM) interactions, regulate multiple cell biological processes including adhesion, migration, proliferation and growth factor-dependent signaling. The principal laminin (LM) binding integrins α3β1, α6β1 and α6β4 are usually co-expressed in cells and bind to multiple laminins with different affinities making it difficult to define their specific function. In this study, we generated kidney epithelial collecting duct (CD) cells that lack both the α3 and α6 integrin subunits. This deletion impaired cell adhesion and migration to LM-332 and LM-511 more than deleting α3 or α6 alone. Cell adhesion mediated by both α3β1 and α6 integrins was PI3K independent, but required K63-linked polyubiquitination of Akt by the ubiquitin-modifying enzyme TRAF6. Moreover, we provide evidence that glial-derived neurotrophic factor (GDNF) and fibroblast growth factor 10 (FGF10)- mediated cell signaling, spreading and proliferation were severely compromised in double integrin α3/α6- but not single α3- or α6-null CD cells. Interestingly, these growth factor-dependent cell functions required both PI3K- and TRAF6-dependent Akt activation. These data suggest that expression of the integrin α3 or α6 subunit is sufficient to mediate GDNF- and FGF10-dependent spreading, proliferation and signaling on LM-511. Thus, our study shows that α3 and α6 containing integrins promote distinct functions and signaling by CD cells on laminin substrata.
MeSH term(s)	Animals ; Cell Adhesion/drug effects ; Cell Adhesion Molecules/chemistry ; Cell Adhesion Molecules/metabolism ; Cell Movement/drug effects ; Cell Proliferation/drug effects ; Epithelial Cells/cytology ; Epithelial Cells/drug effects ; Epithelial Cells/metabolism ; Extracellular Matrix/chemistry ; Extracellular Matrix/drug effects ; Extracellular Matrix/metabolism ; Fibroblast Growth Factor 10/pharmacology ; Gene Deletion ; Gene Expression Regulation ; Glial Cell Line-Derived Neurotrophic Factor/pharmacology ; Humans ; Integrin alpha3/genetics ; Integrin alpha3/metabolism ; Integrin alpha3beta1/genetics ; Integrin alpha3beta1/metabolism ; Integrin alpha6/genetics ; Integrin alpha6/metabolism ; Integrin alpha6beta1/genetics ; Integrin alpha6beta1/metabolism ; Integrin alpha6beta4/genetics ; Integrin alpha6beta4/metabolism ; Intracellular Signaling Peptides and Proteins ; Kidney Tubules, Collecting/cytology ; Kidney Tubules, Collecting/metabolism ; Laminin/chemistry ; Laminin/metabolism ; Mice ; Mice, Knockout ; Phosphatidylinositol 3-Kinases/genetics ; Phosphatidylinositol 3-Kinases/metabolism ; Primary Cell Culture ; Protein Binding ; Proto-Oncogene Proteins c-akt/genetics ; Proto-Oncogene Proteins c-akt/metabolism ; Signal Transduction ; TNF Receptor-Associated Factor 6/genetics ; TNF Receptor-Associated Factor 6/metabolism ; Kalinin
Chemical Substances	Cell Adhesion Molecules ; FGF10 protein, human ; Fibroblast Growth Factor 10 ; Glial Cell Line-Derived Neurotrophic Factor ; Integrin alpha3 ; Integrin alpha3beta1 ; Integrin alpha6 ; Integrin alpha6beta1 ; Integrin alpha6beta4 ; Intracellular Signaling Peptides and Proteins ; Laminin ; TNF Receptor-Associated Factor 6 ; Tifab protein, human ; laminin 10 ; Proto-Oncogene Proteins c-akt (EC 2.7.11.1)
Language	English
Publishing date	2018-09-04
Publishing country	Netherlands
Document type	Journal Article ; Research Support, N.I.H., Extramural ; Research Support, U.S. Gov't, Non-P.H.S.
ZDB-ID	1183793-7
ISSN	1569-1802 ; 0945-053X
ISSN (online)	1569-1802
ISSN	0945-053X
DOI	10.1016/j.matbio.2018.08.010
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 1694: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (1.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Rac1 promotes kidney collecting duct integrity by limiting actomyosin activity.

Bock, Fabian / Elias, Bertha C / Dong, Xinyu / Parekh, Diptiben V / Mernaugh, Glenda / Viquez, Olga M / Hassan, Anjana / Amara, Venkateswara Rao / Liu, Jiageng / Brown, Kyle L / Terker, Andrew S / Chiusa, Manuel / Gewin, Leslie S / Fogo, Agnes B / Brakebusch, Cord H / Pozzi, Ambra / Zent, Roy

The Journal of cell biology

2021 Volume 220, Issue 11

Abstract: A polarized collecting duct (CD), formed from the branching ureteric bud (UB), is a prerequisite for an intact kidney. The small Rho GTPase Rac1 is critical for actin cytoskeletal regulation. We investigated the role of Rac1 in the kidney collecting ... ...

Abstract	A polarized collecting duct (CD), formed from the branching ureteric bud (UB), is a prerequisite for an intact kidney. The small Rho GTPase Rac1 is critical for actin cytoskeletal regulation. We investigated the role of Rac1 in the kidney collecting system by selectively deleting it in mice at the initiation of UB development. The mice exhibited only a mild developmental phenotype; however, with aging, the CD developed a disruption of epithelial integrity and function. Despite intact integrin signaling, Rac1-null CD cells had profound adhesion and polarity abnormalities that were independent of the major downstream Rac1 effector, Pak1. These cells did however have a defect in the WAVE2-Arp2/3 actin nucleation and polymerization apparatus, resulting in actomyosin hyperactivity. The epithelial defects were reversible with direct myosin II inhibition. Furthermore, Rac1 controlled lateral membrane height and overall epithelial morphology by maintaining lateral F-actin and restricting actomyosin. Thus, Rac1 promotes CD epithelial integrity and morphology by restricting actomyosin via Arp2/3-dependent cytoskeletal branching.
MeSH term(s)	Actin Cytoskeleton/metabolism ; Actins/metabolism ; Actomyosin/metabolism ; Animals ; Cell Adhesion/physiology ; Cell Polarity/physiology ; Cells, Cultured ; Cytoskeleton/metabolism ; Epithelial Cells/metabolism ; Kidney Tubules, Collecting/metabolism ; Mice ; Mice, Inbred C57BL ; Myosin Type II/metabolism ; Neuropeptides/metabolism ; Signal Transduction/physiology ; rac1 GTP-Binding Protein/metabolism
Chemical Substances	Actins ; Neuropeptides ; Rac1 protein, mouse ; Actomyosin (9013-26-7) ; Myosin Type II (EC 3.6.1.-) ; rac1 GTP-Binding Protein (EC 3.6.5.2)
Language	English
Publishing date	2021-10-14
Publishing country	United States
Document type	Journal Article ; Research Support, N.I.H., Extramural ; Research Support, Non-U.S. Gov't ; Research Support, U.S. Gov't, Non-P.H.S.
ZDB-ID	218154-x
ISSN	1540-8140 ; 0021-9525
ISSN (online)	1540-8140
ISSN	0021-9525
DOI	10.1083/jcb.202103080
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Ub I Zs.190: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Ligand-independent integrin β1 signaling supports lung adenocarcinoma development.

JCI insight

2022 Volume 7, Issue 15

Abstract: Integrins - the principal extracellular matrix (ECM) receptors of the cell - promote cell adhesion, migration, and proliferation, which are key events for cancer growth and metastasis. To date, most integrin-targeted cancer therapeutics have disrupted ... ...

Abstract	Integrins - the principal extracellular matrix (ECM) receptors of the cell - promote cell adhesion, migration, and proliferation, which are key events for cancer growth and metastasis. To date, most integrin-targeted cancer therapeutics have disrupted integrin-ECM interactions, which are viewed as critical for integrin functions. However, such agents have failed to improve cancer patient outcomes. We show that the highly expressed integrin β1 subunit is required for lung adenocarcinoma development in a carcinogen-induced mouse model. Likewise, human lung adenocarcinoma cell lines with integrin β1 deletion failed to form colonies in soft agar and tumors in mice. Mechanistically, we demonstrate that these effects do not require integrin β1-mediated adhesion to ECM but are dependent on integrin β1 cytoplasmic tail-mediated activation of focal adhesion kinase (FAK). These studies support a critical role for integrin β1 in lung tumorigenesis that is mediated through constitutive, ECM binding-independent signaling involving the cytoplasmic tail.
MeSH term(s)	Adenocarcinoma/genetics ; Adenocarcinoma of Lung/genetics ; Animals ; Humans ; Integrin beta1/genetics ; Integrin beta1/metabolism ; Integrins ; Ligands ; Lung Neoplasms/pathology ; Mice
Chemical Substances	Integrin beta1 ; Integrins ; Ligands
Language	English
Publishing date	2022-08-08
Publishing country	United States
Document type	Journal Article ; Research Support, U.S. Gov't, Non-P.H.S. ; Research Support, N.I.H., Extramural
ISSN	2379-3708
ISSN (online)	2379-3708
DOI	10.1172/jci.insight.154098
Database	MEDical Literature Analysis and Retrieval System OnLINE

Order via subito

Inter-library loan at ZB MED

Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

Article ; Online: Peripheral nerve and brain differ in their capacity to resolve N,N-diethyldithiocarbamate-mediated elevations in copper and oxidative injury.

Valentine, Holly L / Viquez, Olga M / Valentine, William M

Toxicology

2010 Volume 274, Issue 1-3, Page(s) 10–17

Abstract: Previous studies have demonstrated that N,N-diethyldithiocarbamate (DEDC) elevates copper and promotes oxidative stress within the nervous system. However, whether these effects resolve following cessation of exposure or have the potential to persist and ...

Abstract	Previous studies have demonstrated that N,N-diethyldithiocarbamate (DEDC) elevates copper and promotes oxidative stress within the nervous system. However, whether these effects resolve following cessation of exposure or have the potential to persist and result in cumulative injury has not been determined. In this study, an established model for DEDC myelin injury in the rat was used to determine whether copper levels, oxidative stress, and neuromuscular deficits resolve following the cessation of DEDC exposure. Rats were exposed to DEDC for 8 weeks and then either euthanized or maintained for 2, 6 or 12 weeks after cessation of exposure. At each time point copper levels were measured by inductively coupled mass spectrometry to assess the ability of sciatic nerve, brain, spinal cord and liver to eliminate excess copper post-exposure. The protein expression levels of glutathione transferase alpha, heme oxygenase 1 and superoxide dismutase 1 in peripheral nerve and brain were also determined by western blot to assess levels of oxidative stress as a function of post-exposure duration. As an initial assessment of the bioavailability of the excess copper in brain the protein expression levels of copper chaperone for superoxide dismutase 1, and prion protein were determined by western blot as a function of exposure and post-exposure duration. Neuromuscular function in peripheral nerve was evaluated using grip strengths, nerve conduction velocities, and morphologic changes at the light microscope level. The data demonstrated that in peripheral nerve, copper levels and oxidative stress return to control levels within several weeks after cessation of exposure. Neuromuscular function also showed a trend towards pre-exposure values, although the resolution of myelin lesions was more delayed. In contrast, total copper and antioxidant enzyme levels remained significantly elevated in brain for longer post-exposure periods. The persistence of effects observed in brain suggests that the central nervous system is more susceptible to long-term cumulative adverse effects from dithiocarbamates. Additionally, significant changes in expression levels of chaperone for superoxide dismutase 1, and prion protein were observed consistent with at least a portion of the excess copper being bioactive.
MeSH term(s)	Animals ; Blotting, Western ; Brain/drug effects ; Brain/enzymology ; Brain/metabolism ; Copper/metabolism ; Copper/pharmacology ; Ditiocarb/metabolism ; Ditiocarb/pharmacology ; Glutathione Transferase/metabolism ; Glutathione Transferase/pharmacology ; Heme Oxygenase-1/metabolism ; Heme Oxygenase-1/pharmacology ; Liver/metabolism ; Male ; Mass Spectrometry ; Myelin Sheath/drug effects ; Myelin Sheath/metabolism ; Myelin Sheath/pathology ; Oxidation-Reduction ; Oxidative Stress/drug effects ; Oxidative Stress/physiology ; Peripheral Nerves/drug effects ; Peripheral Nerves/metabolism ; Peripheral Nerves/pathology ; Rats ; Rats, Sprague-Dawley ; Sciatic Nerve/drug effects ; Sciatic Nerve/metabolism ; Sciatic Nerve/pathology ; Spinal Cord/metabolism ; Superoxide Dismutase ; Superoxide Dismutase-1
Chemical Substances	Copper (789U1901C5) ; Ditiocarb (99Z2744345) ; Heme Oxygenase-1 (EC 1.14.14.18) ; Sod1 protein, rat (EC 1.15.1.1) ; Superoxide Dismutase (EC 1.15.1.1) ; Superoxide Dismutase-1 (EC 1.15.1.1) ; Glutathione Transferase (EC 2.5.1.18)
Language	English
Publishing date	2010-05-07
Publishing country	Ireland
Document type	Journal Article ; Research Support, N.I.H., Extramural
ZDB-ID	184557-3
ISSN	1879-3185 ; 0300-483X
ISSN (online)	1879-3185
ISSN	0300-483X
DOI	10.1016/j.tox.2010.04.018
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 888: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (1.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article ; Online: Electrophilic adduction of ubiquitin activating enzyme E1 by N,N-diethyldithiocarbamate inhibits ubiquitin activation and is accompanied by striatal injury in the rat.

Viquez, Olga M / Caito, Samuel W / McDonald, W Hayes / Friedman, David B / Valentine, William M

Chemical research in toxicology

2012 Volume 25, Issue 11, Page(s) 2310–2321

Abstract: Previous studies have shown ubiquitin activating enzyme E1 to be sensitive to adduction through both Michael addition and SN(2) chemistry in vitro. E1 presents a biologically important putative protein target for adduction due to its role in initiating ... ...

Abstract	Previous studies have shown ubiquitin activating enzyme E1 to be sensitive to adduction through both Michael addition and SN(2) chemistry in vitro. E1 presents a biologically important putative protein target for adduction due to its role in initiating ubiquitin based protein processing and the involvement of impaired ubiquitin protein processing in two types of familial Parkinson's disease. We tested whether E1 is susceptible to xenobiotic-mediated electrophilic adduction in vivo and explored the potential contribution of E1 adduction to neurodegenerative events in an animal model. N,N-Diethyldithiocarbamate (DEDC) was administered to rats using a protocol that produces covalent cysteine modifications in vivo, and brain E1 protein adducts were characterized and mapped using shotgun LC-MS/MS. E1 activity, global and specific protein expression, and protein carbonyls were used to characterize cellular responses and injury in whole brain and dorsal striatal samples. The data demonstrate that DEDC treatment produced S-(ethylaminocarbonyl) adducts on Cys234 and Cys179 residues of E1 and decreased the levels of activated E1 and total ubiquitinated proteins. Proteomic analysis of whole brain samples identified expression changes for proteins involved in myelin structure, antioxidant response, and catechol metabolism, systems often disrupted in neurodegenerative disease. Our studies also delineated localized injury within the striatum as indicated by decreased levels of tyrosine hydroxylase, elevated protein carbonyl content, increased antioxidant enzyme and α-synuclein expression, and enhanced phosphorylation of tau and tyrosine hydroxylase. These data are consistent with E1 having similar susceptibility to adduction in vivo as previously reported in vitro and support further investigation into environmental agent adduction of E1 as a potential contributing factor to neurodegenerative disease. Additionally, this study supports the predictive value of in vitro screens for identifying sensitive protein targets that can be used to guide subsequent in vivo experiments.
MeSH term(s)	Animals ; Corpus Striatum/drug effects ; Corpus Striatum/injuries ; Corpus Striatum/metabolism ; Ditiocarb/administration & dosage ; Ditiocarb/analogs & derivatives ; Ditiocarb/chemistry ; Ditiocarb/pharmacology ; Enzyme Activation/drug effects ; Enzyme Inhibitors/administration & dosage ; Enzyme Inhibitors/chemistry ; Enzyme Inhibitors/pharmacology ; Humans ; Male ; Models, Molecular ; Rats ; Rats, Sprague-Dawley ; Structure-Activity Relationship ; Ubiquitin-Activating Enzymes/antagonists & inhibitors ; Ubiquitin-Activating Enzymes/isolation & purification ; Ubiquitin-Activating Enzymes/metabolism
Chemical Substances	Enzyme Inhibitors ; Ditiocarb (99Z2744345) ; Ubiquitin-Activating Enzymes (EC 6.2.1.45) ; dihydroxyethyldithiocarbamate (IP73T3KT1R)
Language	English
Publishing date	2012-08-22
Publishing country	United States
Document type	Journal Article ; Research Support, N.I.H., Extramural ; Research Support, Non-U.S. Gov't
ZDB-ID	639353-6
ISSN	1520-5010 ; 0893-228X
ISSN (online)	1520-5010
ISSN	0893-228X
DOI	10.1021/tx300198h
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 2320: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (2.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article: Genomic organization of peanut allergen gene, Ara h 3.

Viquez, Olga M / Konan, Koffi N / Dodo, Hortense W

Molecular immunology

2004 Volume 41, Issue 12, Page(s) 1235–1240

Abstract: Type 1 hypersensitivity to peanut proteins is a well-recognized health problem. Several peanut seed storage proteins have been identified as allergens. Ara h 3, a glycinin protein, is one of the important peanut allergens. Although amino acid and cDNA ... ...

Abstract	Type 1 hypersensitivity to peanut proteins is a well-recognized health problem. Several peanut seed storage proteins have been identified as allergens. Ara h 3, a glycinin protein, is one of the important peanut allergens. Although amino acid and cDNA sequences are available for Ara h 3, there is not information at the genomic level. The objectives of this study were to isolate, sequence, and characterize the genomic clone of peanut allergen, Ara h 3. A peanut genomic library was screened, using two [32P] end-labeled oligonucleotide probes designed based on cDNA sequences of Ara h 3 and Ara h 4. Four positives lambda FIX II clones were obtained after four rounds of screenings. Digestion with Sac I resulted in two fragments of 1.5 and 10 kb hybridizing to the probes. Both fragments were subcloned into p-Bluescript vector and sequenced. The Ara h 3 gene spans 3.5 kb and consists of four exons, three introns, 5' and 3' flanking regions. The open reading frame is 2008 bp long and can encode a polypeptide of 538 amino acids residues. Sequences analogous to a TATA-box (TATAAAT), CAAT-box (AGGA), G-box (TCCTACGTGTCC) and several cis-elements were found in the promoter region. In the 3' downstream region, three polyadenylation signals (AATAAA) were identified.
MeSH term(s)	Allergens/genetics ; Antigens, Plant ; Arachis/immunology ; Base Sequence ; Gene Components ; Genome ; Molecular Sequence Data ; Plant Proteins/immunology ; Seed Storage Proteins ; Sequence Analysis, DNA
Chemical Substances	Allergens ; Antigens, Plant ; Plant Proteins ; Seed Storage Proteins ; allergen Ara h3
Language	English
Publishing date	2004-11
Publishing country	England
Document type	Journal Article ; Research Support, U.S. Gov't, Non-P.H.S.
ZDB-ID	424427-8
ISSN	1872-9142 ; 0161-5890
ISSN (online)	1872-9142
ISSN	0161-5890
DOI	10.1016/j.molimm.2004.06.033
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 166: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (1.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

Article: Structure and organization of the genomic clone of a major peanut allergen gene, Ara h 1.

Viquez, Olga M / Konan, Koffi N / Dodo, Hortense W

Molecular immunology

2003 Volume 40, Issue 9, Page(s) 565–571

Abstract: Peanut is one of the most allergenic foods. It contains multiple seed storage proteins identified as allergens, which are responsible for triggering IgE-mediated allergic reactions. Ara h 1 is a major peanut allergen recognized by over 90% of peanut ... ...

Abstract	Peanut is one of the most allergenic foods. It contains multiple seed storage proteins identified as allergens, which are responsible for triggering IgE-mediated allergic reactions. Ara h 1 is a major peanut allergen recognized by over 90% of peanut sensitive population. The objectives of this study were to isolate, sequence, and determine the structure and organization of at least one genomic clone encoding Ara h 1. Two 100 bp oligonucleotides were synthesized and used as probes to screen a peanut genomic library constructed in a Lambda FIX II vector. After three rounds of screening, four putative positive clones were selected and their DNA digested with SacI. A unique 12-13 kb insert fragment was released, confirmed positive by Southern hybridization, subcloned into a pBluescript vector, and sequenced. Sequence analysis revealed a full-length Ara h 1 gene of 4447 bp with four exons of 721, 176, 81 and 903 bp and three introns of 71, 249 and 74 bp. The deduced amino acid encodes a protein of 626 residues that is identical to the Ara h 1 cDNA clone P41b. Several well characterized elements for promoter strength were found in the promoter region of Ara h 1 and include two TATA-boxes (TATATAAATA and TTATATATAT) at positions -89 and -348, respectively; a CAAT-box (CAAT) at position -133, a GC-box (CGGGACCGGGCCGG GCCTTCGGGCCGGGCCGGGT) at position -475, two G-boxes (TAACACGTACAC and ATGGACGTGAAA) at positions -264 and -1808, respectively; two RY elements (CATGCAC and CATGCAT) at positions -235 and -278, respectively; and other cis-element sequences. In the 3' UTR, a poly-A signal (AATAAA) was found at +2350, two additional stop codons (TAA) at +2303 and +2306, and TTTG/CTA/G motifs. Three introns and a potentially strong promoter could explain the high expression of the Ara h 1 gene. Amino acid sequence comparisons revealed high sequence similarity with other plant vicilins, member of the cupin superfamily.
MeSH term(s)	Allergens ; Amino Acid Sequence ; Antigens, Plant ; Base Sequence ; Gene Library ; Glycoproteins ; Molecular Sequence Data ; Plant Proteins/genetics ; Promoter Regions, Genetic
Chemical Substances	Allergens ; Antigens, Plant ; Ara h 1 protein, Arachis hypogaea ; Glycoproteins ; Plant Proteins
Language	English
Publishing date	2003-08-28
Publishing country	England
Document type	Journal Article
ZDB-ID	424427-8
ISSN	1872-9142 ; 0161-5890
ISSN (online)	1872-9142
ISSN	0161-5890
DOI	10.1016/j.molimm.2003.09.002
Database	MEDical Literature Analysis and Retrieval System OnLINE

In stock of ZB MED Cologne/Königswinter

Zs.A 166: Show issues

Location:
Je nach Verfügbarkeit (siehe Angabe bei Bestand)
bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
Jg. 1995 - 2021: Lesesall (1.OG)
ab Jg. 2022: Lesesaal (EG)

Order via subito

Details ▾
- See ZB MED holdings
- Order with fees

To top

More links

Kategorien

Order via subito

More links

Kategorien

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

Order via subito

Inter-library loan at ZB MED

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito

More links

Kategorien

In stock of ZB MED Cologne/Königswinter

Order via subito