LIVIVO - The Search Portal for Life Sciences

zur deutschen Oberfläche wechseln
Advanced search

Search results

Result 1 - 10 of total 371

Search options

  1. Article ; Online: Kinetic and Mechanistic Studies of the Terminal Uridylyltransferase, Zcchc11 (TUT4).

    Stein, Ross L / Wilson, David M

    Biochemistry

    2022  Volume 61, Issue 15, Page(s) 1614–1624

    Abstract: Zcchc11 (TUT4, TENT3A, Z11) is a nucleotidyltransferase that catalyzes the 3'-polyuridylation of RNA. Our interest in this enzyme stems from its role in blocking the biogenesis ... ...

    Abstract Zcchc11 (TUT4, TENT3A, Z11) is a nucleotidyltransferase that catalyzes the 3'-polyuridylation of RNA. Our interest in this enzyme stems from its role in blocking the biogenesis of
    MeSH term(s) Adenosine Triphosphate ; Cytidine Triphosphate ; MicroRNAs/genetics ; Nucleosides ; RNA Nucleotidyltransferases ; Uridine Monophosphate/metabolism ; Uridine Triphosphate
    Chemical Substances MicroRNAs ; Nucleosides ; Cytidine Triphosphate (65-47-4) ; Adenosine Triphosphate (8L70Q75FXE) ; Uridine Monophosphate (E2OU15WN0N) ; RNA Nucleotidyltransferases (EC 2.7.7.-) ; UTP-RNA uridylyltransferase (EC 2.7.7.-) ; Uridine Triphosphate (UT0S826Z60)
    Language English
    Publishing date 2022-07-07
    Publishing country United States
    Document type Journal Article
    ZDB-ID 1108-3
    ISSN 1520-4995 ; 0006-2960
    ISSN (online) 1520-4995
    ISSN 0006-2960
    DOI 10.1021/acs.biochem.2c00146
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 217: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (1.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  2. Article ; Online: Genomic stress and impaired DNA repair in Alzheimer disease.

    Neven, Jolien / Issayama, Luidy Kazuo / Dewachter, Ilse / Wilson, David M

    DNA repair

    2024  Volume 139, Page(s) 103678

    Abstract: Alzheimer disease (AD) is the most prominent form of dementia and has received considerable attention due to its growing burden on economic, healthcare and basic societal infrastructures. The two major neuropathological hallmarks of AD, i.e., ... ...

    Abstract Alzheimer disease (AD) is the most prominent form of dementia and has received considerable attention due to its growing burden on economic, healthcare and basic societal infrastructures. The two major neuropathological hallmarks of AD, i.e., extracellular amyloid beta (Aβ) peptide plaques and intracellular hyperphosphorylated Tau neurofibrillary tangles, have been the focus of much research, with an eye on understanding underlying disease mechanisms and identifying novel therapeutic avenues. One often overlooked aspect of AD is how Aβ and Tau may, through indirect and direct mechanisms, affect genome integrity. Herein, we review evidence that Aβ and Tau abnormalities induce excessive genomic stress and impair genome maintenance mechanisms, events that can promote DNA damage-induced neuronal cell loss and associated brain atrophy.
    Language English
    Publishing date 2024-04-11
    Publishing country Netherlands
    Document type Journal Article
    ZDB-ID 2071608-4
    ISSN 1568-7856 ; 1568-7864
    ISSN (online) 1568-7856
    ISSN 1568-7864
    DOI 10.1016/j.dnarep.2024.103678
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 5555: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (2.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  3. Article ; Online: Enabling translational geroscience by broadening the scope of geriatric care.

    Ferrucci, Luigi / Wilson, David M / Donega, Stefano / Montano, Monty

    Aging cell

    2023  Volume 23, Issue 1, Page(s) e14034

    Abstract: Geroscience poses that core biological mechanisms of aging contribute to chronic diseases and disabilities in late life and that health span and longevity can be modulated by pharmacological and behavioral interventions. Despite strong evidence from ... ...

    Abstract Geroscience poses that core biological mechanisms of aging contribute to chronic diseases and disabilities in late life and that health span and longevity can be modulated by pharmacological and behavioral interventions. Despite strong evidence from studies in model organisms and great potentials for translation, most geriatricians remain skeptical that geroscience will help them in the day-by-day battle with the consequences of aging in their patients. We believe that a closer collaboration between gerontologists and geriatricians is the key to overcome this impasse. There is evidence that trajectories of health with aging are rooted in intrinsic and extrinsic exposures that occur early in life and affect the pace of molecular and cellular damage accumulation with aging, also referred to as the "pace" of biological aging. Tools that measure the pace of aging currently allow for the identification of individuals experiencing accelerated aging and at higher risk of multimorbidity and disability. What we term "Translational Geroscience", i.e., the merger of fundamental and translational science with clinical practice, is thus poised to extend the action of geriatric care to a life course perspective. By targeting core mechanisms of aging, gerotherapeutics should be effective in treating patients with multimorbidity and disability, phenotypes that are all too common among geriatric patients nowadays. We call for initiatives that enhance the flow of ideas between gerontologists and geriatricians to facilitate the growth of translational geroscience. This approach can widen the scope of geriatric care, including a new role for geroscience in the promotion and operationalization of healthy longevity.
    MeSH term(s) Humans ; Aged ; Geriatrics ; Geroscience ; Aging ; Longevity ; Health Status
    Language English
    Publishing date 2023-12-01
    Publishing country England
    Document type Journal Article
    ZDB-ID 2113083-8
    ISSN 1474-9726 ; 1474-9718
    ISSN (online) 1474-9726
    ISSN 1474-9718
    DOI 10.1111/acel.14034
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 6581: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  4. Article ; Online: The energy-splicing resilience axis hypothesis of aging.

    Ferrucci, Luigi / Wilson, David M / Donegà, Stefano / Gorospe, Myriam

    Nature aging

    2023  Volume 2, Issue 3, Page(s) 182–185

    MeSH term(s) RNA Splicing ; Aging
    Language English
    Publishing date 2023-04-29
    Publishing country United States
    Document type Journal Article ; Research Support, N.I.H., Intramural
    ISSN 2662-8465
    ISSN (online) 2662-8465
    DOI 10.1038/s43587-022-00189-w
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

    Inter-library loan at ZB MED

    Your chosen title can be delivered directly to ZB MED Cologne location if you are registered as a user at ZB MED Cologne.

  5. Article ; Online: Genome Integrity and Neurological Disease.

    Scheijen, Elle E M / Wilson, David M

    International journal of molecular sciences

    2022  Volume 23, Issue 8

    Abstract: Neurological complications directly impact the lives of hundreds of millions of people worldwide. While the precise molecular mechanisms that underlie neuronal cell loss remain under debate, evidence indicates that the accumulation of genomic DNA damage ... ...

    Abstract Neurological complications directly impact the lives of hundreds of millions of people worldwide. While the precise molecular mechanisms that underlie neuronal cell loss remain under debate, evidence indicates that the accumulation of genomic DNA damage and consequent cellular responses can promote apoptosis and neurodegenerative disease. This idea is supported by the fact that individuals who harbor pathogenic mutations in DNA damage response genes experience profound neuropathological manifestations. The review article here provides a general overview of the nervous system, the threats to DNA stability, and the mechanisms that protect genomic integrity while highlighting the connections of DNA repair defects to neurological disease. The information presented should serve as a prelude to the Special Issue "Genome Stability and Neurological Disease", where experts discuss the role of DNA repair in preserving central nervous system function in greater depth.
    MeSH term(s) DNA Damage/genetics ; DNA Repair/genetics ; Genome ; Genomic Instability ; Humans ; Neurodegenerative Diseases/genetics
    Language English
    Publishing date 2022-04-08
    Publishing country Switzerland
    Document type Journal Article ; Review
    ZDB-ID 2019364-6
    ISSN 1422-0067 ; 1422-0067 ; 1661-6596
    ISSN (online) 1422-0067
    ISSN 1422-0067 ; 1661-6596
    DOI 10.3390/ijms23084142
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  6. Article: Oxidative DNA Damage in the Pathophysiology of Spinal Cord Injury: Seems Obvious, but Where Is the Evidence?

    Scheijen, Elle E M / Hendrix, Sven / Wilson, David M

    Antioxidants (Basel, Switzerland)

    2022  Volume 11, Issue 9

    Abstract: Oxidative stress occurs at various phases of spinal cord injury (SCI), promoting detrimental processes such as free radical injury of proteins, nucleic acids, lipids, cytoskeleton, and organelles. Oxidative DNA damage is likely a major contributor to the ...

    Abstract Oxidative stress occurs at various phases of spinal cord injury (SCI), promoting detrimental processes such as free radical injury of proteins, nucleic acids, lipids, cytoskeleton, and organelles. Oxidative DNA damage is likely a major contributor to the pathogenesis of SCI, as a damaged genome cannot be simply turned over to avert detrimental molecular and cellular outcomes, most notably cell death. Surprisingly, the evidence to support this hypothesis is limited. There is some evidence that oxidative DNA damage is increased following SCI, mainly using comet assays and immunohistochemistry. However, there is great variability in the timing and magnitude of its appearance, likely due to differences in experimental models, measurement techniques, and the rigor of the approach. Evidence indicates that 8-oxodG is most abundant at 1 and 7 days post-injury (dpi), while DNA strand breaks peak at 7 and 28 dpi. The DNA damage response seems to be characterized by upregulation of PCNA and PARP1 but downregulation of APEX1. Significant improvements in the analysis of oxidative DNA damage and repair after SCI, including single-cell analysis at time points representative for each phase post-injury using new methodologies and better reporting, will uncover the role of DNA damage and repair in SCI.
    Language English
    Publishing date 2022-08-31
    Publishing country Switzerland
    Document type Journal Article ; Review
    ZDB-ID 2704216-9
    ISSN 2076-3921
    ISSN 2076-3921
    DOI 10.3390/antiox11091728
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  7. Article: Kinetic and Mechanistic Studies of the Terminal Uridylyltransferase, Zcchc11 (TUT4)

    Stein, Ross L. / Wilson, David M.

    Biochemistry. 2022 July 07, v. 61, no. 15

    2022  

    Abstract: Zcchc11 (TUT4, TENT3A, Z11) is a nucleotidyltransferase that catalyzes the 3′-polyuridylation of RNA. Our interest in this enzyme stems from its role in blocking the biogenesis of let-7, a family of microRNAs whose members act as tumor suppressors. Z11 ... ...

    Abstract Zcchc11 (TUT4, TENT3A, Z11) is a nucleotidyltransferase that catalyzes the 3′-polyuridylation of RNA. Our interest in this enzyme stems from its role in blocking the biogenesis of let-7, a family of microRNAs whose members act as tumor suppressors. Z11 polyuridylates pre-let-7, the precursor of let-7, when pre-let-7 is complexed with LIN28, an RNA-binding protein. Polyuridylation of pre-let-7 marks it for degradation. In addition to this LIN28-dependent activity, Z11 also has LIN28-independent activities. In this paper, we report the results of experiments that characterize LIN28-independent activities of Z11. Significant observations include the following. (1) Z11 uridylates not only mature let-7 species but also substrates as small as dinucleotides. (2) For both let-7i and the diribonucleotide AG, Z11 follows a steady-state ordered mechanism, with UTP adding before RNA. (3) Uridylation kinetics of let-7i (UGAGGUAGUAGUUUGUGCUGUU) and two truncated derivatives, GCUGUU and UU, indicate that Z11 manifests selectivity in Kₘ,RNA; kcₐₜ,RNA values for the three substrates are nearly identical. (4) Z11 preferentially uridylates RNA lacking base-pairing near the 3′ terminus. (5) Selectivity of Z11 toward ribonucleoside triphosphates is similar for let-7i and AG, with XTP preference: UTP > CTP > ATP ≫ GTP. Selectivity is manifested in Kₘ,XTP, with kcₐₜ,XTP values being similar for UTP, CTP, and ATP. (6) Kinetic parameters for RNA turnover are dependent on the structure of the nucleoside triphosphate, consistent with recent structural data indicating stacking of the nucleoside triphosphate base with the base of the 3′-nucleotide of the substrate RNA (Faehnle et al., Nat. Struct. Mol. Biol. 2017, 24, 658).
    Keywords RNA-binding proteins ; biogenesis ; microRNA ; neoplasms ; nucleosides
    Language English
    Dates of publication 2022-0707
    Size p. 1614-1624.
    Publishing place American Chemical Society
    Document type Article
    ZDB-ID 1108-3
    ISSN 1520-4995 ; 0006-2960
    ISSN (online) 1520-4995
    ISSN 0006-2960
    DOI 10.1021/acs.biochem.2c00146
    Database NAL-Catalogue (AGRICOLA)

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 217: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (1.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  8. Article ; Online: Connecting aging biology and inflammation in the omics era.

    Walker, Keenan A / Basisty, Nathan / Wilson, David M / Ferrucci, Luigi

    The Journal of clinical investigation

    2022  Volume 132, Issue 14

    Abstract: Aging is characterized by the accumulation of damage to macromolecules and cell architecture that triggers a proinflammatory state in blood and solid tissues, termed inflammaging. Inflammaging has been implicated in the pathogenesis of many age- ... ...

    Abstract Aging is characterized by the accumulation of damage to macromolecules and cell architecture that triggers a proinflammatory state in blood and solid tissues, termed inflammaging. Inflammaging has been implicated in the pathogenesis of many age-associated chronic diseases as well as loss of physical and cognitive function. The search for mechanisms that underlie inflammaging focused initially on the hallmarks of aging, but it is rapidly expanding in multiple directions. Here, we discuss the threads connecting cellular senescence and mitochondrial dysfunction to impaired mitophagy and DNA damage, which may act as a hub for inflammaging. We explore the emerging multi-omics efforts that aspire to define the complexity of inflammaging - and identify molecular signatures and novel targets for interventions aimed at counteracting excessive inflammation and its deleterious consequences while preserving the physiological immune response. Finally, we review the emerging evidence that inflammation is involved in brain aging and neurodegenerative diseases. Our goal is to broaden the research agenda for inflammaging with an eye on new therapeutic opportunities.
    MeSH term(s) Aging/genetics ; Biology ; Cellular Senescence/physiology ; DNA Damage ; Humans ; Inflammation/pathology
    Language English
    Publishing date 2022-07-15
    Publishing country United States
    Document type Journal Article ; Review ; Research Support, Non-U.S. Gov't ; Research Support, N.I.H., Intramural ; Research Support, N.I.H., Extramural
    ZDB-ID 3067-3
    ISSN 1558-8238 ; 0021-9738
    ISSN (online) 1558-8238
    ISSN 0021-9738
    DOI 10.1172/JCI158448
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Ua VI Zs.184: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 2021: Bestellungen von Artikeln über das Online-Bestellformular
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  9. Article: PSMA-Targeted Nanotheranostics for Imaging and Radiotherapy of Prostate Cancer.

    Meher, Niranjan / VanBrocklin, Henry F / Wilson, David M / Flavell, Robert R

    Pharmaceuticals (Basel, Switzerland)

    2023  Volume 16, Issue 2

    Abstract: Targeted nanotheranostic systems offer significant benefits due to the integration of diagnostic and therapeutic functionality, promoting personalized medicine. In recent years, prostate-specific membrane antigen (PSMA) has emerged as an ideal ... ...

    Abstract Targeted nanotheranostic systems offer significant benefits due to the integration of diagnostic and therapeutic functionality, promoting personalized medicine. In recent years, prostate-specific membrane antigen (PSMA) has emerged as an ideal theranostic target, fueling multiple new drug approvals and changing the standard of care in prostate cancer (PCa). PSMA-targeted nanosystems such as self-assembled nanoparticles (NPs), liposomal structures, water-soluble polymers, dendrimers, and other macromolecules are under development for PCa theranostics due to their multifunctional sensing and therapeutic capabilities. Herein, we discuss the significance and up-to-date development of "PSMA-targeted nanocarrier systems for radioligand imaging and therapy of PCa". The review also highlights critical parameters for designing nanostructured radiopharmaceuticals for PCa, including radionuclides and their chelators, PSMA-targeting ligands, and the EPR effect. Finally, prospects and potential for clinical translation is discussed.
    Language English
    Publishing date 2023-02-17
    Publishing country Switzerland
    Document type Journal Article ; Review
    ZDB-ID 2193542-7
    ISSN 1424-8247
    ISSN 1424-8247
    DOI 10.3390/ph16020315
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

  10. Article ; Online: General Synthesis of

    Tao, Min / Qian, Jiasheng / Chen, Zuanguang / An, Lin-Kun / Wilson, David M / Liu, Jianbo

    The Journal of organic chemistry

    2023  Volume 88, Issue 21, Page(s) 15237–15248

    Abstract: We report the one-pot synthesis ... ...

    Abstract We report the one-pot synthesis of
    Language English
    Publishing date 2023-10-12
    Publishing country United States
    Document type Journal Article
    ZDB-ID 123490-0
    ISSN 1520-6904 ; 0022-3263
    ISSN (online) 1520-6904
    ISSN 0022-3263
    DOI 10.1021/acs.joc.3c01740
    Database MEDical Literature Analysis and Retrieval System OnLINE

    More links

    Kategorien

    In stock of ZB MED Cologne/Königswinter

    Zs.A 4473: Show issues Location:
    Je nach Verfügbarkeit (siehe Angabe bei Bestand)
    bis Jg. 1994: Bestellungen von Artikeln über das Online-Bestellformular
    Jg. 1995 - 2021: Lesesall (2.OG)
    ab Jg. 2022: Lesesaal (EG)

    Order via subito

    This service is chargeable due to the Delivery terms set by subito. Orders including an article and supplementary material will be classified as separate orders. In these cases, fees will be demanded for each order.

To top